•
Methods Useful in Genetics and Oncology
a
....................... ~
gcactgaggaagatgctgaaaccttctatgacaactctacaa (intron8;2.7kb )ctcc
ttactgcaatgatttgatgaagaatttggagtctagtcctctttcccgcattatctggaaa
fluorsc.in •
•
..... LC . -61 _ 0 _ _ _ _ _ _ _ _
gctctgaagccgctgctcgttgggaagatc ctgtatacacctgacactccagccacaaggc
~ ......................... .
aggtcatggctgag{ intron9;O.3kb )gtgaacaagaccttccaggaact
b
.........................
agagtgattcgcgtgggtacccgcaagagccag( intron2;325bp )cttgctcgcatac
agacggacagtgtggtggcaacattgaaagcctcgtaccctggcctgcagtttgaaatca
(intron3;374bp )ttgctatgtccaccacaggggacaagattcttgatactgcactctc
taag (intron4;85bp ) attggagagaaaagcctgtttaccaaggagcttgaa catgccc
Fluorescein
•
LC-610
tggagaagaatgaa
gcccactgtgcttcctcctggcttcaccatcggagcc
Fig. la,b. Positions of PCR primers and hybridization probes used in the assay. a AReAl fragment. A pair of primers (dotted arrows, italics) amplify a 205-bp fragment of the ABCA1 eDNA,
containing a part of exon 8, exon 9 and the first 23 bp of exon 10 (position in mRNA:
1013-1217 bp). The ABCA1 donor hybridization probe (green solid line) and ABCA1 acceptor
hybridization probe (red solid line) are separated by one nucleotide. b PBGD fragment. A pair of
primers (dotted arrows, italics) amplify a 282-bp fragment of PBGD eDNA, containing a part of
exon 2, exon 3, exon 4 and almost the entire exon 6 (position mRNA 85-366 bp). The PBGD
donor hybridization probe (green solid line) and the PBGD acceptor hybridization probe (red
solid line) are separated by two nucleotides
each sample, whereas another aliquot served to determine PBGD expression. In
Fig. 2a, the real-time PCR curves from the amplification of the ABCAI cRNA dilutions (for generating the standard curve) and unknown sample (lung in this
example) are displayed. The amplification of both transcripts was performed
simultaneously during the same run. Figure 3a and b (top panels) displays the
amplification of ABCAl and PBGD targets in various human tissues. To characterize both amplified products, melting curves were generated for all samples
Methods Useful in Genetics and Oncology
a
....................... ~
gcactgaggaagatgctgaaaccttctatgacaactctacaa (intron8;2.7kb )ctcc
ttactgcaatgatttgatgaagaatttggagtctagtcctctttcccgcattatctggaaa
fluorsc.in •
•
..... LC . -61 _ 0 _ _ _ _ _ _ _ _
gctctgaagccgctgctcgttgggaagatc ctgtatacacctgacactccagccacaaggc
~ ......................... .
aggtcatggctgag{ intron9;O.3kb )gtgaacaagaccttccaggaact
b
.........................
agagtgattcgcgtgggtacccgcaagagccag( intron2;325bp )cttgctcgcatac
agacggacagtgtggtggcaacattgaaagcctcgtaccctggcctgcagtttgaaatca
(intron3;374bp )ttgctatgtccaccacaggggacaagattcttgatactgcactctc
taag (intron4;85bp ) attggagagaaaagcctgtttaccaaggagcttgaa catgccc
Fluorescein
•
LC-610
tggagaagaatgaa
gcccactgtgcttcctcctggcttcaccatcggagcc
Fig. la,b. Positions of PCR primers and hybridization probes used in the assay. a AReAl fragment. A pair of primers (dotted arrows, italics) amplify a 205-bp fragment of the ABCA1 eDNA,
containing a part of exon 8, exon 9 and the first 23 bp of exon 10 (position in mRNA:
1013-1217 bp). The ABCA1 donor hybridization probe (green solid line) and ABCA1 acceptor
hybridization probe (red solid line) are separated by one nucleotide. b PBGD fragment. A pair of
primers (dotted arrows, italics) amplify a 282-bp fragment of PBGD eDNA, containing a part of
exon 2, exon 3, exon 4 and almost the entire exon 6 (position mRNA 85-366 bp). The PBGD
donor hybridization probe (green solid line) and the PBGD acceptor hybridization probe (red
solid line) are separated by two nucleotides
each sample, whereas another aliquot served to determine PBGD expression. In
Fig. 2a, the real-time PCR curves from the amplification of the ABCAI cRNA dilutions (for generating the standard curve) and unknown sample (lung in this
example) are displayed. The amplification of both transcripts was performed
simultaneously during the same run. Figure 3a and b (top panels) displays the
amplification of ABCAl and PBGD targets in various human tissues. To characterize both amplified products, melting curves were generated for all samples