The sequences of primer sets of GAPDH:
Forward primer, 5
0 - AACTTTGGCATTGTGGAAGGG
CTC-3
0 ;
Reverse primer, 5
0 - TGGAAGAGTGGGAGTTGCTG
TTGA-3
0 .
2.4 Other Materials
1. Electroporation buffer: 25 mM KCl, 0.3 mM KH 2 PO 4 ,
0.85 mM K 2 HPO 4 , 36 mM myo-inositol, pH 7.2, and conductivity 3.5 mS/cm. Store at 4
C.
2. Isopropyl alcohol (IPA) and deionized water.
3. Hexamethyldisiloxane (HMDS).
4. Silane A-174 solution that can enhance Parylene adhesion:
Silane A-174: IPA: DI ¼ 100: 100: 1.
5. AZ 9260 thick film photoresist and AZ 400 K Developer,
Microchemicals GmbH, Germany.
6. Baker PRS-3000 photoresist stripper and residue remover.
7. Gold electroplate solution: ECF-88 K, Sanmei Kasei Co., Ltd.,
Japan.
8. Au etching solution: in a mixing ratio of KI–I 2 –H 2 O ¼
4 g:1 g:40 ml. Store at 25
C.
9. Hydrofluoric acid (HF).
10. Injection syringe 1 ml.
11. Sterile swabs.
12. Medical adhesive tape.
13. Electrical tape.
3 Method
The proposed transdermal electroporation procedure is shown in
Fig. 1. First, we create microchannels on the skin with microneedle
rollers. Then we smear the nucleic acid drugs on the target area.
Finally, the electroporation is processed using flexible interdigitated
electroporation array (FIEA). Before all of that, we will firstly
present the details of fabrication of FIEA.
3.1 Microelectrode
Patch Fabrication
The planar rectangular interdigital microelectrode patch is utilized
as the electroporation electrode, since that could produce a
uniform electric field in the target tissues [11]. Gold and
Parylene C, respectively, are chosen as the electrode and substrate
materials due to good biocompatibility and flexibility. Additionally,
good light-admitting quality of Parylene film could also offer realtime monitoring throughout the whole electroporation process.
106
Dong Huang et al.
Forward primer, 5
0 - AACTTTGGCATTGTGGAAGGG
CTC-3
0 ;
Reverse primer, 5
0 - TGGAAGAGTGGGAGTTGCTG
TTGA-3
0 .
2.4 Other Materials
1. Electroporation buffer: 25 mM KCl, 0.3 mM KH 2 PO 4 ,
0.85 mM K 2 HPO 4 , 36 mM myo-inositol, pH 7.2, and conductivity 3.5 mS/cm. Store at 4
C.
2. Isopropyl alcohol (IPA) and deionized water.
3. Hexamethyldisiloxane (HMDS).
4. Silane A-174 solution that can enhance Parylene adhesion:
Silane A-174: IPA: DI ¼ 100: 100: 1.
5. AZ 9260 thick film photoresist and AZ 400 K Developer,
Microchemicals GmbH, Germany.
6. Baker PRS-3000 photoresist stripper and residue remover.
7. Gold electroplate solution: ECF-88 K, Sanmei Kasei Co., Ltd.,
Japan.
8. Au etching solution: in a mixing ratio of KI–I 2 –H 2 O ¼
4 g:1 g:40 ml. Store at 25
C.
9. Hydrofluoric acid (HF).
10. Injection syringe 1 ml.
11. Sterile swabs.
12. Medical adhesive tape.
13. Electrical tape.
3 Method
The proposed transdermal electroporation procedure is shown in
Fig. 1. First, we create microchannels on the skin with microneedle
rollers. Then we smear the nucleic acid drugs on the target area.
Finally, the electroporation is processed using flexible interdigitated
electroporation array (FIEA). Before all of that, we will firstly
present the details of fabrication of FIEA.
3.1 Microelectrode
Patch Fabrication
The planar rectangular interdigital microelectrode patch is utilized
as the electroporation electrode, since that could produce a
uniform electric field in the target tissues [11]. Gold and
Parylene C, respectively, are chosen as the electrode and substrate
materials due to good biocompatibility and flexibility. Additionally,
good light-admitting quality of Parylene film could also offer realtime monitoring throughout the whole electroporation process.
106
Dong Huang et al.
