2.2 Microneedle and
Corresponding
Apparatuses
1. Commercial microneedle roller: Derma Roller System
600, and there are 10 rows on the head, with 60 needles per
row. The space between rows is 2 mm. The derma roller comes
in several different needle lengths (0.5–2 mm long) depending
on the thickness of the target skin (see Note 6).
2. Electroporator: ECM 830 Electroporation System, BTX, USA
(see Note 7).
3. Connecting wire: copper wire with 0.5 mm diameter.
4. Conductive silver adhesive.
5. Eppendorf pipette Vol: 0.5–10 μl.
2.3 Animals and
Nucleic Acids
1. Male C57BL/6 mice (age 6–8 weeks), Vital River Laboratories, China. In our assay, Animals are maintained in Peking
University Laboratory Animal Center, which is an AAALACaccredited and specific pathogen-free (SPF) experimental animal facility. All of the experimental animals in our study are
treated in accordance with protocols approved by the Institutional Animal Care and Use Committee of Peking University.
2. Depilatory cream (Veet
®
) is purchased online from JingDong
Website.
3. Anesthetic: chloral hydrate solution 4% (w/v).
4. Medical alcohol.
5. DNA and siRNA: In our experiment, a pmRFP-C1 plasmid
encoding a red fluorescent protein is used to determine the
transfection efficiency of plasmid DNA, and that is purified
using commercial kit (EndoFree Plasmid Maxi Kit, TIANGEN, China). Cy5-labeled siRNA is utilized to indicate the
transfection of siRNA. It is stabilized with certain chemical
modifications and with a Cy5 fluorophore on the 5
0 end of
the sense strand. Anti-SCD1 siRNA is also demonstrated using
the proposed protocol. The oligonucleotide sequences for
RT-PCR are presented below. It must be pointed out that the
oligonucleotide sequence does not affect the electroporation
efficiency. All of the oligonucleotides are chemically modified at
certain bases to enhance stability and avoid potential immune
responses.
The sequence of Cy5-labeled siRNA:
Sense, 5
0 -Cy5-CCUUGAGGCAUACUUCAAAdTdT-3
0 ;
Antisense, 5
0 -UUUGAAGUAUGCCUCAAGGdTdT-3
0 .
The sequences of PCR primer sets of SCD1:
Forward primer, 5
0 -TGGTGAACAGTGCCGCGCAT-3
0 ;
Reverse primer, 5
0 - ACTCAGAAGCCCAAAGCTCAGCT
AC-3
0 .
Transdermal Delivery of Nucleic Acid Mediated by Punching and Electroporation
105
Corresponding
Apparatuses
1. Commercial microneedle roller: Derma Roller System
600, and there are 10 rows on the head, with 60 needles per
row. The space between rows is 2 mm. The derma roller comes
in several different needle lengths (0.5–2 mm long) depending
on the thickness of the target skin (see Note 6).
2. Electroporator: ECM 830 Electroporation System, BTX, USA
(see Note 7).
3. Connecting wire: copper wire with 0.5 mm diameter.
4. Conductive silver adhesive.
5. Eppendorf pipette Vol: 0.5–10 μl.
2.3 Animals and
Nucleic Acids
1. Male C57BL/6 mice (age 6–8 weeks), Vital River Laboratories, China. In our assay, Animals are maintained in Peking
University Laboratory Animal Center, which is an AAALACaccredited and specific pathogen-free (SPF) experimental animal facility. All of the experimental animals in our study are
treated in accordance with protocols approved by the Institutional Animal Care and Use Committee of Peking University.
2. Depilatory cream (Veet
®
) is purchased online from JingDong
Website.
3. Anesthetic: chloral hydrate solution 4% (w/v).
4. Medical alcohol.
5. DNA and siRNA: In our experiment, a pmRFP-C1 plasmid
encoding a red fluorescent protein is used to determine the
transfection efficiency of plasmid DNA, and that is purified
using commercial kit (EndoFree Plasmid Maxi Kit, TIANGEN, China). Cy5-labeled siRNA is utilized to indicate the
transfection of siRNA. It is stabilized with certain chemical
modifications and with a Cy5 fluorophore on the 5
0 end of
the sense strand. Anti-SCD1 siRNA is also demonstrated using
the proposed protocol. The oligonucleotide sequences for
RT-PCR are presented below. It must be pointed out that the
oligonucleotide sequence does not affect the electroporation
efficiency. All of the oligonucleotides are chemically modified at
certain bases to enhance stability and avoid potential immune
responses.
The sequence of Cy5-labeled siRNA:
Sense, 5
0 -Cy5-CCUUGAGGCAUACUUCAAAdTdT-3
0 ;
Antisense, 5
0 -UUUGAAGUAUGCCUCAAGGdTdT-3
0 .
The sequences of PCR primer sets of SCD1:
Forward primer, 5
0 -TGGTGAACAGTGCCGCGCAT-3
0 ;
Reverse primer, 5
0 - ACTCAGAAGCCCAAAGCTCAGCT
AC-3
0 .
Transdermal Delivery of Nucleic Acid Mediated by Punching and Electroporation
105