5. A stock of 200 mM of isopropyl β-D-1-thiogalactopyranoside
(IPTG) for bacterial induction of gene expression.
6. A stock of 2 mg/mL L-arabinose for bacterial induction of
gene expression.
7. Murine macrophage medium: 50 mL fetal bovine serum (heat
inactivated), 5 mL 100 mM MEM sodium pyruvate, 5 mL 1 M
HEPES buffer, 5 mL penicillin/streptomycin solution, and
1.25 g of D-(+)-glucose in 500 mL of phenol red-containing
RPMI was mixed and sterile filtered through a 0.2 μm pore
sized membrane.
8. MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide).
9. Sodium dodecyl sulfate.
10. TrypLE Express enzyme solution (Thermo Fisher Scientific).
11. Bright Glo assay kit (Promega).
12. Dimethyl sulfoxide (DMSO).
13. Isotemp 637D incubator (Fisher Scientific; for bacterial
growth on solid plates).
14. MaxQ 4000 Orbital incubator shaker (Fisher Scientific; for
bacterial liquid culture).
15. Symphony Air Jacketed CO 2 incubator 5.3A (VWR; for mammalian cell culture).
3 Methods
3.1 Plasmid
Preparation
1. Perform PCR for the LyE gene using the following primers: a
forward primer of 5
0 - GGGAATTCGATGGTACGCTG
GACTTTGTGG-3
0 and a reverse primer of 5
0 -AGGAAGCTT
TCACTCCTTCCGCACGTAATT-3
0
yielding EcoRI and
HindIII digestion sites at each end (see Note 1).
2. Subject the PCR-amplified LyE gene to electrophoresis using
100 V at constant amplitude with a 0.8% DNA agarose gel.
3. Purify PCR-amplified DNA using the GeneJet gel extraction
kit following the manufacturer’s instructions.
4. Digest purified DNA with EcoRI and HindIII for 1 h at 37
C.
5. Following the restriction enzyme digestion, subject the DNA
to electrophoresis as described above.
6. Purify digested DNA using a GeneJet gel extraction kit.
7. Ligate the digested DNA into EcoRI and HindIII digested
pACYC-Duet to generate the pCYC-LyE plasmid (see Note 2).
8. Heat inactivate the ligation reaction by incubating the reaction
mixture at 65
C for 10 min.
Bactofection Enhancement with ΦX174 Gene E
7
(IPTG) for bacterial induction of gene expression.
6. A stock of 2 mg/mL L-arabinose for bacterial induction of
gene expression.
7. Murine macrophage medium: 50 mL fetal bovine serum (heat
inactivated), 5 mL 100 mM MEM sodium pyruvate, 5 mL 1 M
HEPES buffer, 5 mL penicillin/streptomycin solution, and
1.25 g of D-(+)-glucose in 500 mL of phenol red-containing
RPMI was mixed and sterile filtered through a 0.2 μm pore
sized membrane.
8. MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide).
9. Sodium dodecyl sulfate.
10. TrypLE Express enzyme solution (Thermo Fisher Scientific).
11. Bright Glo assay kit (Promega).
12. Dimethyl sulfoxide (DMSO).
13. Isotemp 637D incubator (Fisher Scientific; for bacterial
growth on solid plates).
14. MaxQ 4000 Orbital incubator shaker (Fisher Scientific; for
bacterial liquid culture).
15. Symphony Air Jacketed CO 2 incubator 5.3A (VWR; for mammalian cell culture).
3 Methods
3.1 Plasmid
Preparation
1. Perform PCR for the LyE gene using the following primers: a
forward primer of 5
0 - GGGAATTCGATGGTACGCTG
GACTTTGTGG-3
0 and a reverse primer of 5
0 -AGGAAGCTT
TCACTCCTTCCGCACGTAATT-3
0
yielding EcoRI and
HindIII digestion sites at each end (see Note 1).
2. Subject the PCR-amplified LyE gene to electrophoresis using
100 V at constant amplitude with a 0.8% DNA agarose gel.
3. Purify PCR-amplified DNA using the GeneJet gel extraction
kit following the manufacturer’s instructions.
4. Digest purified DNA with EcoRI and HindIII for 1 h at 37
C.
5. Following the restriction enzyme digestion, subject the DNA
to electrophoresis as described above.
6. Purify digested DNA using a GeneJet gel extraction kit.
7. Ligate the digested DNA into EcoRI and HindIII digested
pACYC-Duet to generate the pCYC-LyE plasmid (see Note 2).
8. Heat inactivate the ligation reaction by incubating the reaction
mixture at 65
C for 10 min.
Bactofection Enhancement with ΦX174 Gene E
7