Now that you have ordered your mutant, you should design
genotyping primers for future experiments as well to verify that the
mutant you ordered is the mutant you wanted.
1. Go to http://signal.salk.edu/tdnaprimers.2.html.
2. Here, the website displays the relatively straightforward goal of
the genotyping assay you will design. You will order three
primers, two of which you will design. Because the genotyping
is based on insertion of a T-DNA in the region of interest, you
can take advantage of this known sequence for genotyping. The
primers that are for the endogenous (gene) sequences are
denoted as LP and RP (left or right genomic primer). When
used together in a wild-type background, these primers will
produce a ~1-kb amplified fragment after PCR. When LP and
RP are used in the mutant background, no amplified fragment
should be produced (the T-DNA insertion is too long to
amplify with a PCR extension time of one minute). To genotype mutant sequence of interest, you will use RP with a primer
called LBb1 to amplify the right border of the T-DNA insertion. The primer LBb1 is designed specifically for the T-DNA
insertion and can thus be used to genotype any SALK T-DNA
line. When RP and LBb1 are used to amplify mutant sequence,
the resulting fragment should be about 410-bp, but could be as
large as 700-bp. Furthermore, if the primer melting temperatures are similar enough, all three primers can be used in a
single genotyping PCR reaction, also known as a duplex reaction. Please note that for SAIL lines, a different LBb1 primer is
used, as denoted below. In Fig. 30, this information is
displayed.
3. Go to “2. SALK T-DNA verification primer design.” To design
your primers of interest, select primer size (e.g., 20-bp), primer
melting temperature (Tm) (e.g., 61
C), and GC content (e.g.,
20%). Additional parameters of importance are the Max N
(maximum difference of the actual insertion site and the
sequence), as well as Ext5 and Ext3 (regions between the
MaxN to pZone, reserved for not picking primers). Here, it is
best to keep parameters at the defaults.
4. Next, paste in the number for your SALK line interest:
“SALK_138922.” Click “submit.”
5. You will then be taken to a page displaying the following
information:
SALK_138922.50.80.x PRODUCT_SIZE 1253 PAIR_ANY_COMPL 0.00 PAIR_3’_COMPL 0.00 DIFF_TM 0.21
LP TCGGTCCATGGTAGGTAACTG Len 21 TM 59.86
GC 52.38 SELF_ANY_COMPL 0.21 3’_COMPL 0.00 RP
GAGAAGATCCGACTCCAAACC Len 21 TM 60.07 GC
52.38 SELF_ANY_COMPL 0.21 3’_COMPL 0.00 Insertion
chr3 8998753 BP+RP_PRODUCT_SIZE 579-879
82
G. Alex Mason et al.
genotyping primers for future experiments as well to verify that the
mutant you ordered is the mutant you wanted.
1. Go to http://signal.salk.edu/tdnaprimers.2.html.
2. Here, the website displays the relatively straightforward goal of
the genotyping assay you will design. You will order three
primers, two of which you will design. Because the genotyping
is based on insertion of a T-DNA in the region of interest, you
can take advantage of this known sequence for genotyping. The
primers that are for the endogenous (gene) sequences are
denoted as LP and RP (left or right genomic primer). When
used together in a wild-type background, these primers will
produce a ~1-kb amplified fragment after PCR. When LP and
RP are used in the mutant background, no amplified fragment
should be produced (the T-DNA insertion is too long to
amplify with a PCR extension time of one minute). To genotype mutant sequence of interest, you will use RP with a primer
called LBb1 to amplify the right border of the T-DNA insertion. The primer LBb1 is designed specifically for the T-DNA
insertion and can thus be used to genotype any SALK T-DNA
line. When RP and LBb1 are used to amplify mutant sequence,
the resulting fragment should be about 410-bp, but could be as
large as 700-bp. Furthermore, if the primer melting temperatures are similar enough, all three primers can be used in a
single genotyping PCR reaction, also known as a duplex reaction. Please note that for SAIL lines, a different LBb1 primer is
used, as denoted below. In Fig. 30, this information is
displayed.
3. Go to “2. SALK T-DNA verification primer design.” To design
your primers of interest, select primer size (e.g., 20-bp), primer
melting temperature (Tm) (e.g., 61
C), and GC content (e.g.,
20%). Additional parameters of importance are the Max N
(maximum difference of the actual insertion site and the
sequence), as well as Ext5 and Ext3 (regions between the
MaxN to pZone, reserved for not picking primers). Here, it is
best to keep parameters at the defaults.
4. Next, paste in the number for your SALK line interest:
“SALK_138922.” Click “submit.”
5. You will then be taken to a page displaying the following
information:
SALK_138922.50.80.x PRODUCT_SIZE 1253 PAIR_ANY_COMPL 0.00 PAIR_3’_COMPL 0.00 DIFF_TM 0.21
LP TCGGTCCATGGTAGGTAACTG Len 21 TM 59.86
GC 52.38 SELF_ANY_COMPL 0.21 3’_COMPL 0.00 RP
GAGAAGATCCGACTCCAAACC Len 21 TM 60.07 GC
52.38 SELF_ANY_COMPL 0.21 3’_COMPL 0.00 Insertion
chr3 8998753 BP+RP_PRODUCT_SIZE 579-879
82
G. Alex Mason et al.