m Applications in Oncology
can stimulate the MDRI promoter. C-myc, c-fos and c-jun appear to have a direct
effect on MDRI expression [2].
Expression of MDRI has been shown to be an important prognostic indicator
in adult acute myeloid leukemias (AML), non-Hodgkins' lymphoma, multiple
myeloma, pediatric sarcomas involving soft tissue and bone, neuroblastoma, and
small-cell lung cancer [3,4]. Expression of MDRI in adult AML has been linked to
lower remission induction rates and decreased remission duration [3].
A method of accurately and efficiently determining MDRI gene expression in
malignancies is urgently needed because of the suggested prognostic importance of this marker [4, 5]. Additionally, clinical trials with P-gp modulators,
such as PSC833 will also benefit from an improved assay of the MDRI phenotype. We describe here a strategy to develop a real-time quantitative RT-PCR
assay to measure MDRI mRNA. This assay will provide absolute value of the
copy number of MDRI mRNA. Additionally, this assay provides a short turnaround time, about 40 min after RNA preparation, and is suitable for routine
clinical application.
Materials
Equipment
LightCycler instrument (Roche Molecular Biochemicals, Indianapolis, IN)
Reagents Amplification Primers (Idaho Technology, Salt Lake City, UT)
Hybridization Probes (Idaho Technology)
MgCl z Stock Solution (Idaho Technology)
dNTPs (2 mM stock containing dATP, dCTP, dGTP, dTTP)
Taq DNA polymerase (Promega, Madison, WI)
TaqStart antibody (ClonTech, Palo Alto, CA)
Enzyme diluent (10 mM Tris, pH 8.3,250 flg/ml bovine serum albumin)
Procedure
Sample Preparation The total cellular RNA of the chemotherapy agent-sensitive cell line (MES-SA)
and the chemotherapy agent-resistant cell line (MES-SA/DXA) was prepared
using manual methods (RNAzol). Then cDNA was synthesized from 1 flg of
total cellular RNA and 100 ng of random hexadeoxynucleotide primer (Pharmacia) in 10 fll of a solution containing 50 mM Tris, pH 8.3, 75 mM KCI, 3 mM
MgCl z , 10 mM dithiothreitol, 500 flM of each dNTP, and 10 units reverse transcriptase.
Primer Design
The forward (5' CAGGAGATAGGCTGGTTTGAXGT 3', X is the modified T with
Cy5 attached) and the reverse (5' TTAGCTTCCAACCACGTGTAAATC 3') primers
were modified from published data to produce a 172-bp PCR product [6]. The
hybridization probe (3'-fluorescein-Iabeled, 5' GTCGGGTGTTAAGCTCCCCAACATCG 3') were designed according to published guidelines [7,8]. Briefly, the
can stimulate the MDRI promoter. C-myc, c-fos and c-jun appear to have a direct
effect on MDRI expression [2].
Expression of MDRI has been shown to be an important prognostic indicator
in adult acute myeloid leukemias (AML), non-Hodgkins' lymphoma, multiple
myeloma, pediatric sarcomas involving soft tissue and bone, neuroblastoma, and
small-cell lung cancer [3,4]. Expression of MDRI in adult AML has been linked to
lower remission induction rates and decreased remission duration [3].
A method of accurately and efficiently determining MDRI gene expression in
malignancies is urgently needed because of the suggested prognostic importance of this marker [4, 5]. Additionally, clinical trials with P-gp modulators,
such as PSC833 will also benefit from an improved assay of the MDRI phenotype. We describe here a strategy to develop a real-time quantitative RT-PCR
assay to measure MDRI mRNA. This assay will provide absolute value of the
copy number of MDRI mRNA. Additionally, this assay provides a short turnaround time, about 40 min after RNA preparation, and is suitable for routine
clinical application.
Materials
Equipment
LightCycler instrument (Roche Molecular Biochemicals, Indianapolis, IN)
Reagents Amplification Primers (Idaho Technology, Salt Lake City, UT)
Hybridization Probes (Idaho Technology)
MgCl z Stock Solution (Idaho Technology)
dNTPs (2 mM stock containing dATP, dCTP, dGTP, dTTP)
Taq DNA polymerase (Promega, Madison, WI)
TaqStart antibody (ClonTech, Palo Alto, CA)
Enzyme diluent (10 mM Tris, pH 8.3,250 flg/ml bovine serum albumin)
Procedure
Sample Preparation The total cellular RNA of the chemotherapy agent-sensitive cell line (MES-SA)
and the chemotherapy agent-resistant cell line (MES-SA/DXA) was prepared
using manual methods (RNAzol). Then cDNA was synthesized from 1 flg of
total cellular RNA and 100 ng of random hexadeoxynucleotide primer (Pharmacia) in 10 fll of a solution containing 50 mM Tris, pH 8.3, 75 mM KCI, 3 mM
MgCl z , 10 mM dithiothreitol, 500 flM of each dNTP, and 10 units reverse transcriptase.
Primer Design
The forward (5' CAGGAGATAGGCTGGTTTGAXGT 3', X is the modified T with
Cy5 attached) and the reverse (5' TTAGCTTCCAACCACGTGTAAATC 3') primers
were modified from published data to produce a 172-bp PCR product [6]. The
hybridization probe (3'-fluorescein-Iabeled, 5' GTCGGGTGTTAAGCTCCCCAACATCG 3') were designed according to published guidelines [7,8]. Briefly, the
