nonmutagenic version of the rpoB H48Y recombineering oligonucleotide for a negative control, which can be applied for
experiments using the rpoB H48Y positive control or more
generally when targeting any gene experimentally:
(a) 5
0 -A∗A∗T∗T∗CATGGACCAAGCAAACCCATTAGC
TGAGTTAACGCATAAACGTCGTCTATCAGCATTA
GGACCTGGTGGTTTAACACGTGAACGTG-3
0 .
4 Notes
1. Our preferred growth medium for growing S. aureus for electrocompetent cell prep is B2 medium; however, we have found
that some clinical strains are unable to grow in B2 media. In
such cases we have achieved good electroporation efficiencies
after alternatively growing strains in LB or TSB broth.
2. Electrocompetent cells are stable for several months at À80
C.
3. We recommend direct cloning into plasmid artificial modification strains only if transformation efficiency of the electrocompetent cell preparation is high (>1 Â 10
8 CFU per μg pUC19
DNA).
4. Use of other PCR enzymes may be used to perform PCR
amplification, but appropriate amplification conditions must
be empirically established.
5. If the number of colonies obtained with the targeted counterselection vector is roughly equivalent similar to the control
(within a factor of 10), it typically signifies inefficient counterselection. In this situation, redesign of the targeting oligos is
advised.
6. Electroporating recombineering oligonucleotides into
S. aureus decreases the total number of viable cells, to a measurable degree.
References
1. Klevens RM, Morrison MA, Nadle J et al
(2007) Invasive methicillin-resistant Staphylococcus aureus infections in the United States.
JAMA 298:1763–1771. https://doi.org/10.
1001/jama.298.15.1763
2. Wertheim HFL, Vos MC, Ott A et al (2004)
Risk and outcome of nosocomial Staphylococcus aureus bacteraemia in nasal carriers versus
non-carriers. Lancet 364:703–705. https://
doi.org/10.1016/S0140-6736(04)16897-9
3. Liu C, Bayer A, Cosgrove SE et al (2011)
Clinical practice guidelines by the infectious
diseases society of america for the treatment
of methicillin-resistant Staphylococcus aureus
infections in adults and children: executive
summary. Clin Infect Dis 52:285–292.
https://doi.org/10.1093/cid/cir034
4. Lowy FD (1998) Staphylococcus aureus infections. N Engl J Med 339:520–532. https://
doi.org/10.1056/NEJM199808203390806
5. Cullen L, McClean S (2015) Bacterial Adaptation during Chronic Respiratory Infections.
Pathogens 4:66–89. https://doi.org/10.
3390/pathogens4010066
6. Prax M, Lee CY, Bertram R (2013) An update
on the molecular genetics toolbox for
Genome Editing in Staphylococcus aureus by Conditional. . .
141
experiments using the rpoB H48Y positive control or more
generally when targeting any gene experimentally:
(a) 5
0 -A∗A∗T∗T∗CATGGACCAAGCAAACCCATTAGC
TGAGTTAACGCATAAACGTCGTCTATCAGCATTA
GGACCTGGTGGTTTAACACGTGAACGTG-3
0 .
4 Notes
1. Our preferred growth medium for growing S. aureus for electrocompetent cell prep is B2 medium; however, we have found
that some clinical strains are unable to grow in B2 media. In
such cases we have achieved good electroporation efficiencies
after alternatively growing strains in LB or TSB broth.
2. Electrocompetent cells are stable for several months at À80
C.
3. We recommend direct cloning into plasmid artificial modification strains only if transformation efficiency of the electrocompetent cell preparation is high (>1 Â 10
8 CFU per μg pUC19
DNA).
4. Use of other PCR enzymes may be used to perform PCR
amplification, but appropriate amplification conditions must
be empirically established.
5. If the number of colonies obtained with the targeted counterselection vector is roughly equivalent similar to the control
(within a factor of 10), it typically signifies inefficient counterselection. In this situation, redesign of the targeting oligos is
advised.
6. Electroporating recombineering oligonucleotides into
S. aureus decreases the total number of viable cells, to a measurable degree.
References
1. Klevens RM, Morrison MA, Nadle J et al
(2007) Invasive methicillin-resistant Staphylococcus aureus infections in the United States.
JAMA 298:1763–1771. https://doi.org/10.
1001/jama.298.15.1763
2. Wertheim HFL, Vos MC, Ott A et al (2004)
Risk and outcome of nosocomial Staphylococcus aureus bacteraemia in nasal carriers versus
non-carriers. Lancet 364:703–705. https://
doi.org/10.1016/S0140-6736(04)16897-9
3. Liu C, Bayer A, Cosgrove SE et al (2011)
Clinical practice guidelines by the infectious
diseases society of america for the treatment
of methicillin-resistant Staphylococcus aureus
infections in adults and children: executive
summary. Clin Infect Dis 52:285–292.
https://doi.org/10.1093/cid/cir034
4. Lowy FD (1998) Staphylococcus aureus infections. N Engl J Med 339:520–532. https://
doi.org/10.1056/NEJM199808203390806
5. Cullen L, McClean S (2015) Bacterial Adaptation during Chronic Respiratory Infections.
Pathogens 4:66–89. https://doi.org/10.
3390/pathogens4010066
6. Prax M, Lee CY, Bertram R (2013) An update
on the molecular genetics toolbox for
Genome Editing in Staphylococcus aureus by Conditional. . .
141