462
M. Paul et al.
2.5.7 Molecular Identification of Cellulolytic Bacteria by 16S rRNA
Gene Sequencing
Molecular identification of the bacterial strain SCB9 was performed using 16S rRNA
gene sequencing of the DNA isolated from the bacterium. For the DNA extraction
purpose, 1.5 mL of bacterial culture was centrifuged at 10,000 rpm to obtain bacterial cell pellets. The 16S rRNA gene was amplified using Applied Biosystem Verti
Thermal Cycler. The primers for amplification were provided by Sigma-Aldrich.
Universal primers, 27 forward (5AGAGTTTCCTGGCTCAG3) and 1492 reverse
(5ACGGCTACCTTGTTACGATT3), were used for gene amplification. The presence of amplified gene products was determined by 2.5% agarose gel electrophoresis,
and to analyze the size of amplified gene product, DNA markers of 100 bp were used
that were provided by the Puregene. Amplified 16S rRNA gene was purified using
a Gel DNA extraction kit (Qiagen, Seoul, South Korea) and sent for sequencing to
Applied Bioscience Eurofins, Bangalore.
3 Results and Discussion
3.1 Quantitative Assay of Bacterial Cellulase Activity
In accordance with the cellulose hydrolyzing plate assay, bacterial isolates SCB7,
SCB9, and SCB24 showed the highest cellulose-hydrolyzing activity as measured
in DNS method. Obtained spectrometric absorbance values of the three bacterial
isolates implied maximum amount of reducing sugar after the catalytic activity of
cellulase on the substrate carboxy methyl cellulose (Fig. 1). Lynch et al. (1981)
determined the cellulase activities of some aerobic microorganisms isolated from soil.
Cellulose extracted from wheat straw, avicel, and CF11 cellulose powder contained
90% glucose, whereas filter paper and carboxy methyl cellulose contained 18% and
28% hemicelluloses, respectively. Among the microorganisms isolated, only fungi
had cellulase activities and this activity was the greatest cultures of Cladosporium
cladosporoides. Therefore, the current study is in well accordance with the above
study conducted by Lynch et al. (1981) and it can be implied that bacterial strains
with higher cellulolytic efficiency are abundant in the soil sample.
M. Paul et al.
2.5.7 Molecular Identification of Cellulolytic Bacteria by 16S rRNA
Gene Sequencing
Molecular identification of the bacterial strain SCB9 was performed using 16S rRNA
gene sequencing of the DNA isolated from the bacterium. For the DNA extraction
purpose, 1.5 mL of bacterial culture was centrifuged at 10,000 rpm to obtain bacterial cell pellets. The 16S rRNA gene was amplified using Applied Biosystem Verti
Thermal Cycler. The primers for amplification were provided by Sigma-Aldrich.
Universal primers, 27 forward (5AGAGTTTCCTGGCTCAG3) and 1492 reverse
(5ACGGCTACCTTGTTACGATT3), were used for gene amplification. The presence of amplified gene products was determined by 2.5% agarose gel electrophoresis,
and to analyze the size of amplified gene product, DNA markers of 100 bp were used
that were provided by the Puregene. Amplified 16S rRNA gene was purified using
a Gel DNA extraction kit (Qiagen, Seoul, South Korea) and sent for sequencing to
Applied Bioscience Eurofins, Bangalore.
3 Results and Discussion
3.1 Quantitative Assay of Bacterial Cellulase Activity
In accordance with the cellulose hydrolyzing plate assay, bacterial isolates SCB7,
SCB9, and SCB24 showed the highest cellulose-hydrolyzing activity as measured
in DNS method. Obtained spectrometric absorbance values of the three bacterial
isolates implied maximum amount of reducing sugar after the catalytic activity of
cellulase on the substrate carboxy methyl cellulose (Fig. 1). Lynch et al. (1981)
determined the cellulase activities of some aerobic microorganisms isolated from soil.
Cellulose extracted from wheat straw, avicel, and CF11 cellulose powder contained
90% glucose, whereas filter paper and carboxy methyl cellulose contained 18% and
28% hemicelluloses, respectively. Among the microorganisms isolated, only fungi
had cellulase activities and this activity was the greatest cultures of Cladosporium
cladosporoides. Therefore, the current study is in well accordance with the above
study conducted by Lynch et al. (1981) and it can be implied that bacterial strains
with higher cellulolytic efficiency are abundant in the soil sample.