3.4 Methods and Materials
89
3.4 Methods and Materials
3.4.1 Peptide Synthesis
All peptides were synthesized by manual Fmoc-based solid-phase synthesis. The
intramolecular thiol-ene reactions were conducted via the method reported in
previous literature. The resultant cyclic diastereomers were separated by HPLC.
The purified peptides were detected by ESI/LC-MS and the pure fractions were
combined and then lyophilized. The detailed synthesis route for PhR was shown
below, other peptides synthesis in this article are similar to this route (Schemes 3.1,
3.2 and Table 3.2).
3.4.2 Protein Production
Human MDM2 LBD residues 25-117 were cloned into pGEX-4t-1 via EcoRI and
XhoI to generate GST-tagged constructs. Expression was carried out in E. coli BL21
(DE3) and was induced with 0.1 mM IPTG. Cultures were grown in LB medium
at 37°C to an OD 600 of 0.6 before being transferred to 18°C for 24 h. Cells were
harvested by centrifugation and flush frozen. Harvested cells were lysed by sonication
in lysis buffer (20 mM Tris-Cl pH 7.9, 500 mM NaCl). Cell debris was removed by
centrifugation and the supernatant was purified on a 5 mL GST affinity column
(GE healthcare) and eluted with elution buffer (10 mM GSH in 20 mM Tris-Cl pH
7.9, 500 mM NaCl). The protein was further purified with a Superdex 200 column
equilibrated in 20 mM Tris-Cl pH 7.9, 500 mM NaCl, 1 mM DTT.
Primer sequences:
MDM2-EcoRI-25: CCGGAATTCGAGACCCTGGTTAGACCAAA
MDM2-XhoI-117: GTAGGCACTCGAGTCAGTCCGATGATTCCT
3.4.3 Fluorescence Polarization Assay
FITC-labeled peptides (10–20 nM) were incubated with MDM2 or MDMX protein
in binding assay buffer (140 mM NaCl, 50 mM, Tris pH 8.0) at room temperature for
1 h. Fluorescence polarization experiments were performed in 96-well plates (Perkin
Elmer Optiplate-96F) on a plate reader (Perkin Elmer, Envision, 2104 multilabel
reader). Concentrations of the peptides were determined at 494 nm absorption of
FITC. Kd values were determined by nonlinear regression analysis of dose response
curves using OriginPro 9.0.
89
3.4 Methods and Materials
3.4.1 Peptide Synthesis
All peptides were synthesized by manual Fmoc-based solid-phase synthesis. The
intramolecular thiol-ene reactions were conducted via the method reported in
previous literature. The resultant cyclic diastereomers were separated by HPLC.
The purified peptides were detected by ESI/LC-MS and the pure fractions were
combined and then lyophilized. The detailed synthesis route for PhR was shown
below, other peptides synthesis in this article are similar to this route (Schemes 3.1,
3.2 and Table 3.2).
3.4.2 Protein Production
Human MDM2 LBD residues 25-117 were cloned into pGEX-4t-1 via EcoRI and
XhoI to generate GST-tagged constructs. Expression was carried out in E. coli BL21
(DE3) and was induced with 0.1 mM IPTG. Cultures were grown in LB medium
at 37°C to an OD 600 of 0.6 before being transferred to 18°C for 24 h. Cells were
harvested by centrifugation and flush frozen. Harvested cells were lysed by sonication
in lysis buffer (20 mM Tris-Cl pH 7.9, 500 mM NaCl). Cell debris was removed by
centrifugation and the supernatant was purified on a 5 mL GST affinity column
(GE healthcare) and eluted with elution buffer (10 mM GSH in 20 mM Tris-Cl pH
7.9, 500 mM NaCl). The protein was further purified with a Superdex 200 column
equilibrated in 20 mM Tris-Cl pH 7.9, 500 mM NaCl, 1 mM DTT.
Primer sequences:
MDM2-EcoRI-25: CCGGAATTCGAGACCCTGGTTAGACCAAA
MDM2-XhoI-117: GTAGGCACTCGAGTCAGTCCGATGATTCCT
3.4.3 Fluorescence Polarization Assay
FITC-labeled peptides (10–20 nM) were incubated with MDM2 or MDMX protein
in binding assay buffer (140 mM NaCl, 50 mM, Tris pH 8.0) at room temperature for
1 h. Fluorescence polarization experiments were performed in 96-well plates (Perkin
Elmer Optiplate-96F) on a plate reader (Perkin Elmer, Envision, 2104 multilabel
reader). Concentrations of the peptides were determined at 494 nm absorption of
FITC. Kd values were determined by nonlinear regression analysis of dose response
curves using OriginPro 9.0.