FIMO
1. Go to http://meme-suite.org/tools/fimo.
2. Upload the supplied file of DAP-seq motifs (ArabidopsisDAPv1.meme, available here; see Note 15) under the “Input
the motifs” menu. If you open the database file in a text editor,
you will observe PSSMs for ~800 transcription factors assayed
by DAP-seq. Again, PSSMs represent transcription factor binding sites and describe the probability of how often a given
nucleotide can be present at each position of the transcription
factor motif.
3. Under “Input primary sequences,” click the drop-down menu
and select “Type in sequences.” Copy and paste the following
(FASTA format):
>ABI3_upstream_region
atgtctttctctcgaggaactttgtttttatttcttagaagatga
ggggagatttactatctaaataaaattttaaatgtttgtaagtatt
atgagctcaacaattttgtcaatagtgccacaaatttaaacgtttg
ctttttgtcttctttgaaaaatcaaatgctgaaaaactgttacatc
tctttttcttaaaaactcttgtctctctccttttccttctgctga
ggtaattgaatgctgcaaagagaaagagaataacttaaacccaaaa
ttacacttaccgccagaaaaaaaaaagagttcagtttaatctaaca
tattttatacaatacaattgaattatattagtaaaaaaaaaactt
ccatataaatcatggaacaaactggaacacatgggctctctta
ttttaatttattttcttttttgagggatttaaccatgtttattata
tagttttataaatatatatataccatctctccataatttataaaat
4. Under “Enter in job details,” type in your email address and as
well as a job description to remind you of what you submitted.
This step may take more than an hour to run on the MEMEsuite server, so please be patient.
5. When the job is done, you should receive an email with a link to
your results. Click the link and you will be taken to an output
page that has the following links: FIMO HTML output, FIMO
TSV output, Input Sequences, Calculated Alphabet, and Calculated Background. For future data analysis, download the
TSV file. If you open this TSV file using a text editor, you will
see that for each motif that was found to be a match in the input
sequence, information such as location of the motif in the
sequence, p-value, q-value, as well as the matching sequence,
is reported.
6. Click “HTML output.” You will be taken to a page displaying
visual information about the motif scan FIMO performed.
Specifically, we can observe that the IDs of the transcription
factors have highly similar motif matches within the upstream
sequence of ABI3 (see Fig. 11). These are first described by the
family of the transcription factor’s DNA binding domain, followed by the AGI ID.
50
G. Alex Mason et al.
1. Go to http://meme-suite.org/tools/fimo.
2. Upload the supplied file of DAP-seq motifs (ArabidopsisDAPv1.meme, available here; see Note 15) under the “Input
the motifs” menu. If you open the database file in a text editor,
you will observe PSSMs for ~800 transcription factors assayed
by DAP-seq. Again, PSSMs represent transcription factor binding sites and describe the probability of how often a given
nucleotide can be present at each position of the transcription
factor motif.
3. Under “Input primary sequences,” click the drop-down menu
and select “Type in sequences.” Copy and paste the following
(FASTA format):
>ABI3_upstream_region
atgtctttctctcgaggaactttgtttttatttcttagaagatga
ggggagatttactatctaaataaaattttaaatgtttgtaagtatt
atgagctcaacaattttgtcaatagtgccacaaatttaaacgtttg
ctttttgtcttctttgaaaaatcaaatgctgaaaaactgttacatc
tctttttcttaaaaactcttgtctctctccttttccttctgctga
ggtaattgaatgctgcaaagagaaagagaataacttaaacccaaaa
ttacacttaccgccagaaaaaaaaaagagttcagtttaatctaaca
tattttatacaatacaattgaattatattagtaaaaaaaaaactt
ccatataaatcatggaacaaactggaacacatgggctctctta
ttttaatttattttcttttttgagggatttaaccatgtttattata
tagttttataaatatatatataccatctctccataatttataaaat
4. Under “Enter in job details,” type in your email address and as
well as a job description to remind you of what you submitted.
This step may take more than an hour to run on the MEMEsuite server, so please be patient.
5. When the job is done, you should receive an email with a link to
your results. Click the link and you will be taken to an output
page that has the following links: FIMO HTML output, FIMO
TSV output, Input Sequences, Calculated Alphabet, and Calculated Background. For future data analysis, download the
TSV file. If you open this TSV file using a text editor, you will
see that for each motif that was found to be a match in the input
sequence, information such as location of the motif in the
sequence, p-value, q-value, as well as the matching sequence,
is reported.
6. Click “HTML output.” You will be taken to a page displaying
visual information about the motif scan FIMO performed.
Specifically, we can observe that the IDs of the transcription
factors have highly similar motif matches within the upstream
sequence of ABI3 (see Fig. 11). These are first described by the
family of the transcription factor’s DNA binding domain, followed by the AGI ID.
50
G. Alex Mason et al.