11 Hormone Aptamers in Endocrine-Related Diseases
339
prostate cancer. Studies have shown that by using siRNA to suppress the expression
of the androgen receptor(AR) gene, tumor growth in AR-positive prostate cancer
was slowed down [91].
Most prostate cancers are sensitive to androgen, and its receptor is one of the most
important promoters of prostate cancer. The AR has two main functional domains: the
ligand-binding domain (LBD)and the DNA-binding domain (DBD) [92]. Hormonereceptor complexes are transferred to the nucleus and bind to androgen-specific
hormone response elements (HRE) through DBD to regulate gene transcription. The
androgen response element is structurally composed of a short DNA motif with base
sequence specificity in the upstream promoter of the androgen response gene. The
HRE contains a pair of conservative sequences separated by trinucleotide intervals.
The sequence was identified as 5
-GGTACAnnnTGTTCT-3
[93] with 5
-CGG -3
as the spacing region in the androgen response element.
Aptamers that mimic HRE(AMH) can compete with natural HRE on genomic
DNA and weaken the role of androgen complex in inducing transcription of
related genes. This aptamer was designed to treat prostate cancer. The androgen
response element sequence is 5
-GGTACACGGTGTTCT-3
. The designed sequence
is 5
- GCCGTATGGTACACGGTGTTCTAAACTATAAGAACACCGTGTACCA
TACGGC-3
. In this study, AMH is used as a treatment to reduce the proliferation rate
of LNCaP (lymph node carcinoma of the prostate) cells. This suggests that aptamers
may play an antiproliferative role by regulating related transcription factors [94].
Based on the palindromic structure of androgen genomic HREs, an aptamer AMH
is designed to bind the DBD of ARs to compete with HREs. AMH is capable of
competing with native HRE on genomic DNA and reduced the effect of the androgen
hormone complex to induce transcription of related genes.
The present study illustrated that AMH in groups with two concentrations of
DHEA (10 and 100 nM) significantly reduced the proliferation rate of the LNCaP
cell line compared with cells in negative control groups. Using AMH as a therapeutic approach can reduce the proliferation rate of LNCaP cells. AMH could mimic
genomic HRE because of a similar sequence; thus, it may trap AR through its DBD
in the cytoplasm instead of the nucleus [94]. Other studies have shown that with the
suppression of AR gene expression using a siRNA, researchers observed a reduction
of tumor growth in AR-positive prostate cancer [91]. AMH competes with native
HRE and reduces the effect of the androgen hormone-receptor complex to inhibit
proliferation. It seems that the aptamer may exert an antiproliferative effect through
the regulation of related transcription factors [94].
In 2011, Reeb et al. [95] had also designed a peptide aptamer specifically aimed at
the androgen receptor. This new aptamer can inhibit both the AR-mediated transactivation and expression of the androgen receptor target gene PSA. The aptamer-based
corepressor (AB-CoR) is shown to inhibit the growth of human LNCaP prostate
cancer cells. They also created ab-COR, which is permeable to cells, by fusing
protein transduction domains to create carrier-free transport systems. The researchers
found that after treatment of LNCaP cells with AB-CoR peptide from permeable
cells expressed by bacteria and affinity purification, AR-mediated transactivation
and proliferation of prostate cancer cells were significantly inhibited [95].
339
prostate cancer. Studies have shown that by using siRNA to suppress the expression
of the androgen receptor(AR) gene, tumor growth in AR-positive prostate cancer
was slowed down [91].
Most prostate cancers are sensitive to androgen, and its receptor is one of the most
important promoters of prostate cancer. The AR has two main functional domains: the
ligand-binding domain (LBD)and the DNA-binding domain (DBD) [92]. Hormonereceptor complexes are transferred to the nucleus and bind to androgen-specific
hormone response elements (HRE) through DBD to regulate gene transcription. The
androgen response element is structurally composed of a short DNA motif with base
sequence specificity in the upstream promoter of the androgen response gene. The
HRE contains a pair of conservative sequences separated by trinucleotide intervals.
The sequence was identified as 5
-GGTACAnnnTGTTCT-3
[93] with 5
-CGG -3
as the spacing region in the androgen response element.
Aptamers that mimic HRE(AMH) can compete with natural HRE on genomic
DNA and weaken the role of androgen complex in inducing transcription of
related genes. This aptamer was designed to treat prostate cancer. The androgen
response element sequence is 5
-GGTACACGGTGTTCT-3
. The designed sequence
is 5
- GCCGTATGGTACACGGTGTTCTAAACTATAAGAACACCGTGTACCA
TACGGC-3
. In this study, AMH is used as a treatment to reduce the proliferation rate
of LNCaP (lymph node carcinoma of the prostate) cells. This suggests that aptamers
may play an antiproliferative role by regulating related transcription factors [94].
Based on the palindromic structure of androgen genomic HREs, an aptamer AMH
is designed to bind the DBD of ARs to compete with HREs. AMH is capable of
competing with native HRE on genomic DNA and reduced the effect of the androgen
hormone complex to induce transcription of related genes.
The present study illustrated that AMH in groups with two concentrations of
DHEA (10 and 100 nM) significantly reduced the proliferation rate of the LNCaP
cell line compared with cells in negative control groups. Using AMH as a therapeutic approach can reduce the proliferation rate of LNCaP cells. AMH could mimic
genomic HRE because of a similar sequence; thus, it may trap AR through its DBD
in the cytoplasm instead of the nucleus [94]. Other studies have shown that with the
suppression of AR gene expression using a siRNA, researchers observed a reduction
of tumor growth in AR-positive prostate cancer [91]. AMH competes with native
HRE and reduces the effect of the androgen hormone-receptor complex to inhibit
proliferation. It seems that the aptamer may exert an antiproliferative effect through
the regulation of related transcription factors [94].
In 2011, Reeb et al. [95] had also designed a peptide aptamer specifically aimed at
the androgen receptor. This new aptamer can inhibit both the AR-mediated transactivation and expression of the androgen receptor target gene PSA. The aptamer-based
corepressor (AB-CoR) is shown to inhibit the growth of human LNCaP prostate
cancer cells. They also created ab-COR, which is permeable to cells, by fusing
protein transduction domains to create carrier-free transport systems. The researchers
found that after treatment of LNCaP cells with AB-CoR peptide from permeable
cells expressed by bacteria and affinity purification, AR-mediated transactivation
and proliferation of prostate cancer cells were significantly inhibited [95].