338
Y. Cheng and H. Jin
by breast cancer [85]. At present, there are four kinds of, i.e., estrogen receptorpositive, HER2 receptor-positive, progesterone receptor-positive, and triple-negative
breast cancer. The most common form of breast cancer is estrogen receptor-positive,
also known as hormone-sensitive, which means that the growth of tumors requires
the action of estrogen. As breast cancer tumors spread, so did the estrogen receptor.
Estrogen receptor α (ERα) is an important biomarker for breast cancer metastasis. It is
a ligand-activated transcription factor [86]. Binding of estrogen to the ER triggers its
release from molecular chaperones, causing receptor dimerization and subsequent
expression of target genes by recruiting transcriptional factors and DNA-binding
proteins [87]. Selective inhibition of the ER action by selective estrogen receptor
modulators (SERMs) provides an approach to treat or restrict the growth of receptorpositive cancers [88]. The phenomenon requires the precise quantification of ER
expression status to categorize the tumors as ER-positive.
In 2015, Sett [89] developed a novel DNA aptamer-based detection system
for Erα-positive carcinoma. The full domain of nuclear receptor ERα was amplified by specifically designed primers containing restriction enzyme sites Nhe ISal I for pET 28a vector. The primers used to amplify the ERα gene were:
5
GCGCTAGCATGACCATGACCCTC3
(Forward primer containing NheI site),
5
GCGTCGACTCAGACTGTGGCAGG 3
(Reverse primer containing SalI site)
[89]. And the researchers obtained the candidate aptamer ER_Apt1 through 14 iterative cycles of in vitro protein SELEX process. Fluorescence and chemiluminescence
binding assays confirmed the specificity of the candidate aptamer to ER-α positive
breast cancer cell line. Comparative analysis of ER_Apt1 to ERα monoclonal antibody was also performed to analyze the expression of ER-α in various cancer cell
lines. Cytochemical and immunohistochemistry assay indicates ER_Apt1’s potential
use as a diagnostic agent against ERα positive carcinomas.
In 2019, Ahirwar [63] developed an electrochemical sensor using the ERαaptamer for rapid, precise, and cost-effective detection of ERα in human breast
cancer patients. The aptasensor was constructed by covalently immobilizing the
thiolated ERα-aptamer onto a screen-printed gold electrode. The construction of
the aptasensor was confirmed through atomic force microscopy (AFM) and differential pulse voltammetry (DPV) measurements. A detection limit of 0.001 ng/mL
was calculated for full-length ERαwithin a detection timeframe of 10 min [63]. The
researchers have used a recently identified 76-nt DNA aptamer of ERα [90] to develop
an electrochemical sensor for precise and rapid quantification of ERα in breast tissue
lysates. The electric signal varies according to target concentration, allowing the
precise and speedy quantification of ERα in breast tissue lysates [63].
11.3.3.2 Application of Aptamer in Prostate Cancer Treatment
Prostate tumors are usually androgen–dependent. Androgen deprivation therapy,
e.g., surgical castration, medical castration, androgen suppression, and androgen
biosynthesis inhibition, has become the standard first-line treatment for advanced
Y. Cheng and H. Jin
by breast cancer [85]. At present, there are four kinds of, i.e., estrogen receptorpositive, HER2 receptor-positive, progesterone receptor-positive, and triple-negative
breast cancer. The most common form of breast cancer is estrogen receptor-positive,
also known as hormone-sensitive, which means that the growth of tumors requires
the action of estrogen. As breast cancer tumors spread, so did the estrogen receptor.
Estrogen receptor α (ERα) is an important biomarker for breast cancer metastasis. It is
a ligand-activated transcription factor [86]. Binding of estrogen to the ER triggers its
release from molecular chaperones, causing receptor dimerization and subsequent
expression of target genes by recruiting transcriptional factors and DNA-binding
proteins [87]. Selective inhibition of the ER action by selective estrogen receptor
modulators (SERMs) provides an approach to treat or restrict the growth of receptorpositive cancers [88]. The phenomenon requires the precise quantification of ER
expression status to categorize the tumors as ER-positive.
In 2015, Sett [89] developed a novel DNA aptamer-based detection system
for Erα-positive carcinoma. The full domain of nuclear receptor ERα was amplified by specifically designed primers containing restriction enzyme sites Nhe ISal I for pET 28a vector. The primers used to amplify the ERα gene were:
5
GCGCTAGCATGACCATGACCCTC3
(Forward primer containing NheI site),
5
GCGTCGACTCAGACTGTGGCAGG 3
(Reverse primer containing SalI site)
[89]. And the researchers obtained the candidate aptamer ER_Apt1 through 14 iterative cycles of in vitro protein SELEX process. Fluorescence and chemiluminescence
binding assays confirmed the specificity of the candidate aptamer to ER-α positive
breast cancer cell line. Comparative analysis of ER_Apt1 to ERα monoclonal antibody was also performed to analyze the expression of ER-α in various cancer cell
lines. Cytochemical and immunohistochemistry assay indicates ER_Apt1’s potential
use as a diagnostic agent against ERα positive carcinomas.
In 2019, Ahirwar [63] developed an electrochemical sensor using the ERαaptamer for rapid, precise, and cost-effective detection of ERα in human breast
cancer patients. The aptasensor was constructed by covalently immobilizing the
thiolated ERα-aptamer onto a screen-printed gold electrode. The construction of
the aptasensor was confirmed through atomic force microscopy (AFM) and differential pulse voltammetry (DPV) measurements. A detection limit of 0.001 ng/mL
was calculated for full-length ERαwithin a detection timeframe of 10 min [63]. The
researchers have used a recently identified 76-nt DNA aptamer of ERα [90] to develop
an electrochemical sensor for precise and rapid quantification of ERα in breast tissue
lysates. The electric signal varies according to target concentration, allowing the
precise and speedy quantification of ERα in breast tissue lysates [63].
11.3.3.2 Application of Aptamer in Prostate Cancer Treatment
Prostate tumors are usually androgen–dependent. Androgen deprivation therapy,
e.g., surgical castration, medical castration, androgen suppression, and androgen
biosynthesis inhibition, has become the standard first-line treatment for advanced