3.5 Construction
of S6K1-mTurq2
and Raptor-YFP
Plasmid Constructs
1. S6K1-mTurqouise2 construct was generated in a similar manner by insertion into a pOPINE-3C-mTurq2 vector, also
provided by the Protein Production UK (PPUK) using the
primers below:
S6K1-mTurq2 Fwd AGGAGATATACCATGAGGCGACG
AAGGAGGCGG.
S6K1-mTurq2 Rev CAGAACTTCCAGTTTTAGATTCATACGCAGGTGCTCTG.
2. Raptor-YFP was generated by in-fusion cloning the full length
raptor ORF from mDsRed-raptor into the pOPINE-3C-YFP
vector, using the primers below:
raptor-YFP Fwd AGGAGATATACCATGGAGTCCGAAAT
GCTGCAATCG.
raptor-YFP Rev CAGAACTTCCAGTTTTCTGACACGCT
TCTCCACCG.
3. Plasmid constructs were verified by reverse PCR screens and
further validated by Sanger sequencing using T7F primers and
appropriate reverse primers at Source Bioscience (UK).
3.6 Cell Lines
HEK293 cells were cultured in Minimum Essential Media (MEM)
supplemented with 10% (w/v) fetal bovine serum (FBS), 2 mM Lglutamine, and 1% (w/v) penicillin–streptomycin. All culture
reagents were acquired from Life Technologies. Cells were incubated at 37
C with 5% CO 2 humidified air in T75 culture flasks
(Thermo Scientific).
3.7 Cell Transfection
HEK293 was seeded for 24 h at a density of 1 Â 10
5 or
1.5 Â 10
5 cells per ml on uncoated 35 mm no 1.5 glass bottom
dishes (MatTek). Cells were transfected with 0.5 μg of plasmid
DNA using FuGENE HD (Promega) transfection reagent.
3.8 Equipment
for Real-Time Imaging
of Protein–Protein
Interactions Using
a Confocal
and FRET-FLIM Setup
Our two-channel confocal and two-channel FLIM setup was fitted
with time-correlated single-photon counting cards (TCSPC) from
Becker & Hickl (BH SPC 830 or SPC150), and data were analyzed
using the BH SPCImage analysis software v 5.1.
1. Although the two-photon microscopy technique has several
advantages over a one-photon system, it is best to use a
one-photon confocal microscope for the multicolor FRETFLIM technique. This is because the ultrafast femtosecond
pulsed laser is likely to excite both the donor(s) and acceptor
(s) at the same time. This needs to be avoided. For the PIE
operation which is essential for three protein interaction studies, two separate pulsed laser sources are required. It is more
convenient to use two lasers that (1) can vary their repetition
rates, (2) can be synchronized, and (3) can be triggered externally (Fig. 3).
Multicolor FRET-FLIM Microscopy to Analyze Multiprotein Interactions in. . .
295
of S6K1-mTurq2
and Raptor-YFP
Plasmid Constructs
1. S6K1-mTurqouise2 construct was generated in a similar manner by insertion into a pOPINE-3C-mTurq2 vector, also
provided by the Protein Production UK (PPUK) using the
primers below:
S6K1-mTurq2 Fwd AGGAGATATACCATGAGGCGACG
AAGGAGGCGG.
S6K1-mTurq2 Rev CAGAACTTCCAGTTTTAGATTCATACGCAGGTGCTCTG.
2. Raptor-YFP was generated by in-fusion cloning the full length
raptor ORF from mDsRed-raptor into the pOPINE-3C-YFP
vector, using the primers below:
raptor-YFP Fwd AGGAGATATACCATGGAGTCCGAAAT
GCTGCAATCG.
raptor-YFP Rev CAGAACTTCCAGTTTTCTGACACGCT
TCTCCACCG.
3. Plasmid constructs were verified by reverse PCR screens and
further validated by Sanger sequencing using T7F primers and
appropriate reverse primers at Source Bioscience (UK).
3.6 Cell Lines
HEK293 cells were cultured in Minimum Essential Media (MEM)
supplemented with 10% (w/v) fetal bovine serum (FBS), 2 mM Lglutamine, and 1% (w/v) penicillin–streptomycin. All culture
reagents were acquired from Life Technologies. Cells were incubated at 37
C with 5% CO 2 humidified air in T75 culture flasks
(Thermo Scientific).
3.7 Cell Transfection
HEK293 was seeded for 24 h at a density of 1 Â 10
5 or
1.5 Â 10
5 cells per ml on uncoated 35 mm no 1.5 glass bottom
dishes (MatTek). Cells were transfected with 0.5 μg of plasmid
DNA using FuGENE HD (Promega) transfection reagent.
3.8 Equipment
for Real-Time Imaging
of Protein–Protein
Interactions Using
a Confocal
and FRET-FLIM Setup
Our two-channel confocal and two-channel FLIM setup was fitted
with time-correlated single-photon counting cards (TCSPC) from
Becker & Hickl (BH SPC 830 or SPC150), and data were analyzed
using the BH SPCImage analysis software v 5.1.
1. Although the two-photon microscopy technique has several
advantages over a one-photon system, it is best to use a
one-photon confocal microscope for the multicolor FRETFLIM technique. This is because the ultrafast femtosecond
pulsed laser is likely to excite both the donor(s) and acceptor
(s) at the same time. This needs to be avoided. For the PIE
operation which is essential for three protein interaction studies, two separate pulsed laser sources are required. It is more
convenient to use two lasers that (1) can vary their repetition
rates, (2) can be synchronized, and (3) can be triggered externally (Fig. 3).
Multicolor FRET-FLIM Microscopy to Analyze Multiprotein Interactions in. . .
295
