2.3 DNA
The DNA should be ordered from the supplier as a desalted sample,
with standard purification on the smallest synthesis scale.
1. ReDCaT linker: The 20-nucleotide ReDCaT DNA linker (see
Note 4) is ordered with a biotin label added to the 5
0 end. The
sequence of the ReDCaT linker is shown in Table 1. Dilute the
ReDCaT linker to 100 nM concentration in running buffer,
and this can be stored in aliquots at À80
C until required.
2. Test DNA: Forward (F) and reverse (R) strands (see Note 5).
The forward strand comprises just the sequence of DNA to be
tested, whilst the reverse strand includes an additional
20 nucleotides attached to the 3
0 end, which is the complement
to the ReDCaT linker (sequence 5
0
CCTACCC
TACGTCCTCCTGC 3
0 ). Examples of forward and reverse
DNA samples are shown in Table 1. Dilute the F and R DNA
samples to 100 μM in running buffer or water. Mix 55 μl F
strand and 45 μl R strand and heat to 95
C for 10 min and
allow to cool. This gives a stock at 45 μM for the doublestranded DNA (dsDNA; see Note 6). Prior to use, dilute to
1 μM (22 μl dsDNA stock +978 μl running buffer). This should
be done for all the DNA samples to be tested. Store both the
dsDNA stocks and the dilutions at À80
C until required.
3 Methods
The method uses a biotinylated single-stranded (ss) DNA ReDCaT
linker, which is permanently bound to a standard SA chip. Subsequently, a dsDNA oligomer containing the sequence of interest and
bearing an overhang that is complementary to the linker is captured
on the chip through hybridization. At the end of the experiment,
the captured oligonucleotide is stripped from the linker by denaturation to regenerate the chip. Figure 1 shows an illustration of the
ReDCaT method and a representative sensorgram. The technical
details to run the method are presented below.
Table 1
DNA sequences. Examples of the DNA that would be required to prepare the ReDCaT chip and to test
one sequence of DNA
Oligo
Length (bases) Sequence 5
0 to 3
0
ReDCaT linker
20
Biotin- GCAGGAGGACGTAGGGTAGG
Test DNA Forward
36
ACTCCAATACTTGAACTCTCAATCTTTACGTGCCGT
Test DNA Reverse
56
ACGGCACGTAAAGATTGAGAGTTCAAGTATTGGAGT
CCTACCCTACGTCCTCCTGC
SPR Analysis of Protein-DNA Interactions
371
The DNA should be ordered from the supplier as a desalted sample,
with standard purification on the smallest synthesis scale.
1. ReDCaT linker: The 20-nucleotide ReDCaT DNA linker (see
Note 4) is ordered with a biotin label added to the 5
0 end. The
sequence of the ReDCaT linker is shown in Table 1. Dilute the
ReDCaT linker to 100 nM concentration in running buffer,
and this can be stored in aliquots at À80
C until required.
2. Test DNA: Forward (F) and reverse (R) strands (see Note 5).
The forward strand comprises just the sequence of DNA to be
tested, whilst the reverse strand includes an additional
20 nucleotides attached to the 3
0 end, which is the complement
to the ReDCaT linker (sequence 5
0
CCTACCC
TACGTCCTCCTGC 3
0 ). Examples of forward and reverse
DNA samples are shown in Table 1. Dilute the F and R DNA
samples to 100 μM in running buffer or water. Mix 55 μl F
strand and 45 μl R strand and heat to 95
C for 10 min and
allow to cool. This gives a stock at 45 μM for the doublestranded DNA (dsDNA; see Note 6). Prior to use, dilute to
1 μM (22 μl dsDNA stock +978 μl running buffer). This should
be done for all the DNA samples to be tested. Store both the
dsDNA stocks and the dilutions at À80
C until required.
3 Methods
The method uses a biotinylated single-stranded (ss) DNA ReDCaT
linker, which is permanently bound to a standard SA chip. Subsequently, a dsDNA oligomer containing the sequence of interest and
bearing an overhang that is complementary to the linker is captured
on the chip through hybridization. At the end of the experiment,
the captured oligonucleotide is stripped from the linker by denaturation to regenerate the chip. Figure 1 shows an illustration of the
ReDCaT method and a representative sensorgram. The technical
details to run the method are presented below.
Table 1
DNA sequences. Examples of the DNA that would be required to prepare the ReDCaT chip and to test
one sequence of DNA
Oligo
Length (bases) Sequence 5
0 to 3
0
ReDCaT linker
20
Biotin- GCAGGAGGACGTAGGGTAGG
Test DNA Forward
36
ACTCCAATACTTGAACTCTCAATCTTTACGTGCCGT
Test DNA Reverse
56
ACGGCACGTAAAGATTGAGAGTTCAAGTATTGGAGT
CCTACCCTACGTCCTCCTGC
SPR Analysis of Protein-DNA Interactions
371