RNA binding of the individual KH domains within an intact IMP1
KH di-domain structural context. We have used three protein
constructs: wild-type KH1KH2, KH1KH2(DD) (the KH2 KO),
and KH1(DD)KH2 (the KH1 KO). BLI experiments using immobilized MYCRNA exposed to different concentrations of IMP1
allowed us to obtain the equilibrium dissociation constants (K d )
as well as the kinetic parameters for the interactions of two of these
constructs. Typical experimental data for the wild-type and the
KH1KH2(DD) construct are shown in Fig. 2 along with the kinetic
and thermodynamic parameters for the interactions.
In a different study, we again used BLI to investigate the
interaction of β-actin mRNA with a KH3KH4 di-domain from
the chicken orthologue of IMP1, Zipcode binding protein
1 (ZBP1) [15]. The IMP1 protein is conserved from Drosophila
to human, in particular within the KH domains [17]. ZBP1 has the
same RNA-binding properties as the human protein and is often
used as a proxy to study the IMP1–RNA interaction in vitro. As
discussed above, the interaction with the β-actin mRNA is mediated
by the KH3KH4 di-domain [19], which recognizes the 28-nucleotide β-actin 3
0 UTR Zipcode RNA element ( ACCGGACU
GUUACCAACACCCACACCCC) (see Fig. 3). In order to study
the KH3KH4 interaction, we used wild-type protein plus two
GxxG-to-GDDG ZBP1constructs, KH3KH4(DD) (the KH4
KO) and KH3(DD)KH4 (the KH3 KO). This is similar to what
was discussed above for the KH1KH2–RNA interaction. The equilibrium interaction was studied by using immobilized
28-nucleotide Zipcode RNA exposed to different concentrations
of ZBP1 KH3(DD)KH4 and KH3KH4(DD). The equilibrium
dissociation constants for the Zipcode RNA:KH3KH4(DD) and
RNA:KH3(DD)KH4 complexes were found to be ~1.5 μM
and ~0.9 μM, respectively. Although the affinities of the two
domains are similar, the kinetic constants are somewhat different.
Fig. 2 BLI data for the interaction of IMP1 constructs with MYCRNA. (a) Wild-type KH1KH2: serial dilutions from
0.25 μM (0.25, 0.13, 0.06, 0.03 μM). k on ~ 1 Â 10
6
M
À1
s
À1
, k off ~ 0.047 s
À1
, K d ~ 47 nM. (b) KH1KH2(DD):
serial dilutions from 1 μM (1, 0.5, 0.25, 0.13 μM). k on ~ 2.7 Â 10
5
M
À1
s
À1
, k off ~ 0.48 s
À1
, K d ~ 1.76 μM
BLI: Protein-RNA Interactions
361
KH di-domain structural context. We have used three protein
constructs: wild-type KH1KH2, KH1KH2(DD) (the KH2 KO),
and KH1(DD)KH2 (the KH1 KO). BLI experiments using immobilized MYCRNA exposed to different concentrations of IMP1
allowed us to obtain the equilibrium dissociation constants (K d )
as well as the kinetic parameters for the interactions of two of these
constructs. Typical experimental data for the wild-type and the
KH1KH2(DD) construct are shown in Fig. 2 along with the kinetic
and thermodynamic parameters for the interactions.
In a different study, we again used BLI to investigate the
interaction of β-actin mRNA with a KH3KH4 di-domain from
the chicken orthologue of IMP1, Zipcode binding protein
1 (ZBP1) [15]. The IMP1 protein is conserved from Drosophila
to human, in particular within the KH domains [17]. ZBP1 has the
same RNA-binding properties as the human protein and is often
used as a proxy to study the IMP1–RNA interaction in vitro. As
discussed above, the interaction with the β-actin mRNA is mediated
by the KH3KH4 di-domain [19], which recognizes the 28-nucleotide β-actin 3
0 UTR Zipcode RNA element ( ACCGGACU
GUUACCAACACCCACACCCC) (see Fig. 3). In order to study
the KH3KH4 interaction, we used wild-type protein plus two
GxxG-to-GDDG ZBP1constructs, KH3KH4(DD) (the KH4
KO) and KH3(DD)KH4 (the KH3 KO). This is similar to what
was discussed above for the KH1KH2–RNA interaction. The equilibrium interaction was studied by using immobilized
28-nucleotide Zipcode RNA exposed to different concentrations
of ZBP1 KH3(DD)KH4 and KH3KH4(DD). The equilibrium
dissociation constants for the Zipcode RNA:KH3KH4(DD) and
RNA:KH3(DD)KH4 complexes were found to be ~1.5 μM
and ~0.9 μM, respectively. Although the affinities of the two
domains are similar, the kinetic constants are somewhat different.
Fig. 2 BLI data for the interaction of IMP1 constructs with MYCRNA. (a) Wild-type KH1KH2: serial dilutions from
0.25 μM (0.25, 0.13, 0.06, 0.03 μM). k on ~ 1 Â 10
6
M
À1
s
À1
, k off ~ 0.047 s
À1
, K d ~ 47 nM. (b) KH1KH2(DD):
serial dilutions from 1 μM (1, 0.5, 0.25, 0.13 μM). k on ~ 2.7 Â 10
5
M
À1
s
À1
, k off ~ 0.48 s
À1
, K d ~ 1.76 μM
BLI: Protein-RNA Interactions
361