a target-specific primer and primer oriE; for the downstream
gene replacement junction, use a target-specific primer and
primer Hyg
R . The oriE and Hyg
R primers can be used for all
the hygromycin-resistant integrating plasmids; sequences for
these primers are as follows: oriE - CCTGGTATCTTTATAGT
CCTGTCG; HygR - TGCACGGGACCAACACCTTCGTGG
4. For gene knockouts, verify the loss of the target gene. For this
purpose, use primers that generate an internal fragment of the
M. tuberculosis target gene in the parent, but not in the knockout strain (see primer positions #1 and #2 in Fig. 4) (see
Note 18).
3.6 Curing
of pKM461
and Creation of a
Markerless Deletion
Sometimes, pKM461 is lost spontaneously during construction of a
knockout. If this is not the case, one can cure the knockout of the
pKM461 plasmid and remove the drug-resistance maker in one
step. This procedure involves a reversal of the plasmid integration
step, leaving behind an in-frame deletion with the 48 bp attP site in
place of the target gene.
1. Transform the knockout strain with plasmid pKM512 and plate
on 7H10 plates containing 25 μg/mL zeocin (see Note 19).
2. Pick a colony of the knockout strain containing pKM512 and
grow up in 5 mL of 7H9-OADC-Tween 80 containing 25 μg/
mL zeocin to an OD 600 of 1.0 (see Note 20).
3. Spin the culture down at 3500 x g for 10 min and resuspend the
pellet in 5 ml 7H9-OADC-Tween. Dilute 1 ml of the resuspended culture in 9 mL of 7H9-OADC-Tween 80 (no antibiotics) containing 500 μg/mL anhydrotetracycline and grow
back to an OD 600 of 1.0.
4. Streak out the culture on 7H10 plates containing 3% (w/v)
sucrose for single colonies.
5. Screen single colonies for loss of kanamycin, hygromycin, and
zeocin resistance by stabbing on 7H10 plates containing these
drugs, and a control plate with no drug. Incubate the plates at
37
C for 2–3 weeks.
6. Grow up 3 candidates from step 5 in 7H9-OADC-tween and
prepare heat-killed cells (see step 2 from Subheading 3.5).
Verify the presence of the chromosomal attP sequence at the
target site by sequencing a PCR fragment that is generated by
using target specific primers (see Fig. 4, primers #3 and #4).
3.7 SNP Transfer
and ORBIT
in M. smegmatis
All of the steps described above for both the SNP transfer and
ORBIT protocols can also be used for gene editing in
M. smegmatis. Changes, mostly with regard to timing, are described
below.
Oligo-Mediated Recombineering in Mycobacteria
315
gene replacement junction, use a target-specific primer and
primer Hyg
R . The oriE and Hyg
R primers can be used for all
the hygromycin-resistant integrating plasmids; sequences for
these primers are as follows: oriE - CCTGGTATCTTTATAGT
CCTGTCG; HygR - TGCACGGGACCAACACCTTCGTGG
4. For gene knockouts, verify the loss of the target gene. For this
purpose, use primers that generate an internal fragment of the
M. tuberculosis target gene in the parent, but not in the knockout strain (see primer positions #1 and #2 in Fig. 4) (see
Note 18).
3.6 Curing
of pKM461
and Creation of a
Markerless Deletion
Sometimes, pKM461 is lost spontaneously during construction of a
knockout. If this is not the case, one can cure the knockout of the
pKM461 plasmid and remove the drug-resistance maker in one
step. This procedure involves a reversal of the plasmid integration
step, leaving behind an in-frame deletion with the 48 bp attP site in
place of the target gene.
1. Transform the knockout strain with plasmid pKM512 and plate
on 7H10 plates containing 25 μg/mL zeocin (see Note 19).
2. Pick a colony of the knockout strain containing pKM512 and
grow up in 5 mL of 7H9-OADC-Tween 80 containing 25 μg/
mL zeocin to an OD 600 of 1.0 (see Note 20).
3. Spin the culture down at 3500 x g for 10 min and resuspend the
pellet in 5 ml 7H9-OADC-Tween. Dilute 1 ml of the resuspended culture in 9 mL of 7H9-OADC-Tween 80 (no antibiotics) containing 500 μg/mL anhydrotetracycline and grow
back to an OD 600 of 1.0.
4. Streak out the culture on 7H10 plates containing 3% (w/v)
sucrose for single colonies.
5. Screen single colonies for loss of kanamycin, hygromycin, and
zeocin resistance by stabbing on 7H10 plates containing these
drugs, and a control plate with no drug. Incubate the plates at
37
C for 2–3 weeks.
6. Grow up 3 candidates from step 5 in 7H9-OADC-tween and
prepare heat-killed cells (see step 2 from Subheading 3.5).
Verify the presence of the chromosomal attP sequence at the
target site by sequencing a PCR fragment that is generated by
using target specific primers (see Fig. 4, primers #3 and #4).
3.7 SNP Transfer
and ORBIT
in M. smegmatis
All of the steps described above for both the SNP transfer and
ORBIT protocols can also be used for gene editing in
M. smegmatis. Changes, mostly with regard to timing, are described
below.
Oligo-Mediated Recombineering in Mycobacteria
315