170
stable DNA polymerase such as Pfu Turbo polymerase
(e.g., Agilent).
4. Standard desalted oligonucleotide primers for PCR. The primer
stock solution is 10 μM. For illustration, primers used for inserting a proteolytic cleavage site for SplB (available from
ThermoFisher; also known as WELQut protease) between
Tem1 and BLIP are shown: SplB-ins forward:
5 ′-TGGGAACTGCAGGGTTCTAGTGGTGGCGAA
AAAATT- 3′ and SplB- ins reverse: 5′-ACCCTGCAGTTC
CCAACCACCGGCACCACTACCGCCCCAATG -3′.
5. PCR purification kit (e.g., QIAquick PCR purification kit,
QIAGEN).
6. In-Fusion cloning kit (Clontech). The user may substitute
another cloning method of choice instead.
7. Competent E. coli cells for transforming DNA: One Shot
TOP10 Chemically Competent Cells E. coli (e.g., Invitrogen).
8. LB-Kan agar plates: 5 g/L yeast extract, 10 g/L peptone,
10 g/L NaCl, and 15 g/L agar supplemented with 50 μg/mL
kanamycin.
9. LB-Kan liquid medium: 5 g/L yeast extract, 10 g/L peptone,
and 10 g/L NaCl supplemented with 50 μg/mL kanamycin.
10. Commercial plasmid miniprep kit (e.g., Qiagen) or self-made
reagents.
11. Oligonucleotide primers suitable for sequencing newly constructed plasmids. If using the pET28a vector, petF2
(5′-CATCGGTGATGTCGGCGAT-3′) and pETR (5′-CGGA
TATAGTTCCTCCTTTCAGCA- 3′) are suitable for sequencing from the N- and C-terminal ends, respectively.
12. DNA Sequencing facility and suitable sequence analysis software (e.g., DNAStar Lasergene Suite or Snapgene).
1. SHuffle T7 Competent E. coli (NEB). (See also Note 5.
2. LB-Kan agar plates: 10 g/L yeast extract, 20 g/L peptone,
20 g/L sodium chloride, and 15 g/L agar supplemented with
50 μg/mL kanamycin. Other non-ampicillin plates are also
suitable for use with alternative vector systems.
3. LB-Kan liquid medium: 10 g/L yeast extract, 20 g/L peptone, and 20 g/L sodium chloride supplemented with 50 μg/
mL kanamycin.
4. Stock solution for inducing protein expression: 1 M IPTG.
5. Erlenmeyer flasks and incubator-shaker for bacterial cell
culture.
6. Centrifuge for pelleting bacterial cells (e.g. Beckman
ultracentrifuge).
2.2 Expression
of Recombinant
Proteins
Hui Chin Goh et al.
stable DNA polymerase such as Pfu Turbo polymerase
(e.g., Agilent).
4. Standard desalted oligonucleotide primers for PCR. The primer
stock solution is 10 μM. For illustration, primers used for inserting a proteolytic cleavage site for SplB (available from
ThermoFisher; also known as WELQut protease) between
Tem1 and BLIP are shown: SplB-ins forward:
5 ′-TGGGAACTGCAGGGTTCTAGTGGTGGCGAA
AAAATT- 3′ and SplB- ins reverse: 5′-ACCCTGCAGTTC
CCAACCACCGGCACCACTACCGCCCCAATG -3′.
5. PCR purification kit (e.g., QIAquick PCR purification kit,
QIAGEN).
6. In-Fusion cloning kit (Clontech). The user may substitute
another cloning method of choice instead.
7. Competent E. coli cells for transforming DNA: One Shot
TOP10 Chemically Competent Cells E. coli (e.g., Invitrogen).
8. LB-Kan agar plates: 5 g/L yeast extract, 10 g/L peptone,
10 g/L NaCl, and 15 g/L agar supplemented with 50 μg/mL
kanamycin.
9. LB-Kan liquid medium: 5 g/L yeast extract, 10 g/L peptone,
and 10 g/L NaCl supplemented with 50 μg/mL kanamycin.
10. Commercial plasmid miniprep kit (e.g., Qiagen) or self-made
reagents.
11. Oligonucleotide primers suitable for sequencing newly constructed plasmids. If using the pET28a vector, petF2
(5′-CATCGGTGATGTCGGCGAT-3′) and pETR (5′-CGGA
TATAGTTCCTCCTTTCAGCA- 3′) are suitable for sequencing from the N- and C-terminal ends, respectively.
12. DNA Sequencing facility and suitable sequence analysis software (e.g., DNAStar Lasergene Suite or Snapgene).
1. SHuffle T7 Competent E. coli (NEB). (See also Note 5.
2. LB-Kan agar plates: 10 g/L yeast extract, 20 g/L peptone,
20 g/L sodium chloride, and 15 g/L agar supplemented with
50 μg/mL kanamycin. Other non-ampicillin plates are also
suitable for use with alternative vector systems.
3. LB-Kan liquid medium: 10 g/L yeast extract, 20 g/L peptone, and 20 g/L sodium chloride supplemented with 50 μg/
mL kanamycin.
4. Stock solution for inducing protein expression: 1 M IPTG.
5. Erlenmeyer flasks and incubator-shaker for bacterial cell
culture.
6. Centrifuge for pelleting bacterial cells (e.g. Beckman
ultracentrifuge).
2.2 Expression
of Recombinant
Proteins
Hui Chin Goh et al.