5. 100Â penicillin–streptomycin (10,000 U/mL) (Gibco,
ThermoFisher).
6. Sterile serological pipettes (Greiner Bio-One).
7. Multichannel pipette (20–200 μL).
8. Variable Adjustable Volume Pipettes.
9. MultiScreen HTS, 96-well filtration plate (Merck Millipore).
10. Anti-mouse IFN-ɣ, IL-2, IL-4 ELISPOT antibody pairs
(BD Biosciences).
11. LEAF anti-mouse IL-17A and biotin-anti-mouse IL-17A antibody (BioLegend).
12. Phosphate buffered saline (PBS) (Sigma-Aldrich).
13. Fetal calf serum (FCS) (Gibco, ThermoFisher).
14. Red Blood Cell (RBC) Lysis Buffer (155 mM NH 4 Cl; 10 mM
KHCO 3 ; 0.1 mM EDTA, pH 7.3).
15. Hemocytometer.
16. 70% ethanol.
17. Sterile forceps and scissors.
18. CO 2 incubator (Thermo Scientific).
19. ELISPOT plate reader.
3 Methods
3.1 DNA Vaccine
Design and Generation
1. The coding DNA sequences of prME of different flaviviruses
(e.g., MVEV, KUN, WNV, JEV, DENV, or Zika virus) are
either synthesized or achieved by RT-PCR from isolated
viruses. All sequences were codon-optimized by using JCat
(http://www.jcat.de/) and double-checked by other similar
tools (e.g., Genscript’s codon optimization tool; https://
www.genscript.com/gensmart-free-gene-codon-optimization.
html) (see Note 1). In the meantime, common or conflicting
restriction sites (EcoRI, BamHI, XhoI, etc.) will be removed by
silent mutation for easy cloning and flexibility of future subcloning into other DNA vaccine vectors (see Note 2).
2. Once the prME fragments (e.g., DENV2) are digested with
KasI/XhoI enzymes and gel purified, they are ligated into
pcDNA3-JEss vector (Fig. 2) at KasI/XhoI site to make
pcDNA3-JEss-DENV2-prME DNA vaccine (Fig. 3). Because
we need signal peptide for correct trafficking of expressed
prME protein, we have included JEss signal coding sequence
GAGGTCCGCCGGCTCAATCATGTGGCTCGCGAGCTTGGCAGTTGTCATAGCTTGTGCAGGCGCC,
DNA Vaccine Design and Adjuvant Selection
411
ThermoFisher).
6. Sterile serological pipettes (Greiner Bio-One).
7. Multichannel pipette (20–200 μL).
8. Variable Adjustable Volume Pipettes.
9. MultiScreen HTS, 96-well filtration plate (Merck Millipore).
10. Anti-mouse IFN-ɣ, IL-2, IL-4 ELISPOT antibody pairs
(BD Biosciences).
11. LEAF anti-mouse IL-17A and biotin-anti-mouse IL-17A antibody (BioLegend).
12. Phosphate buffered saline (PBS) (Sigma-Aldrich).
13. Fetal calf serum (FCS) (Gibco, ThermoFisher).
14. Red Blood Cell (RBC) Lysis Buffer (155 mM NH 4 Cl; 10 mM
KHCO 3 ; 0.1 mM EDTA, pH 7.3).
15. Hemocytometer.
16. 70% ethanol.
17. Sterile forceps and scissors.
18. CO 2 incubator (Thermo Scientific).
19. ELISPOT plate reader.
3 Methods
3.1 DNA Vaccine
Design and Generation
1. The coding DNA sequences of prME of different flaviviruses
(e.g., MVEV, KUN, WNV, JEV, DENV, or Zika virus) are
either synthesized or achieved by RT-PCR from isolated
viruses. All sequences were codon-optimized by using JCat
(http://www.jcat.de/) and double-checked by other similar
tools (e.g., Genscript’s codon optimization tool; https://
www.genscript.com/gensmart-free-gene-codon-optimization.
html) (see Note 1). In the meantime, common or conflicting
restriction sites (EcoRI, BamHI, XhoI, etc.) will be removed by
silent mutation for easy cloning and flexibility of future subcloning into other DNA vaccine vectors (see Note 2).
2. Once the prME fragments (e.g., DENV2) are digested with
KasI/XhoI enzymes and gel purified, they are ligated into
pcDNA3-JEss vector (Fig. 2) at KasI/XhoI site to make
pcDNA3-JEss-DENV2-prME DNA vaccine (Fig. 3). Because
we need signal peptide for correct trafficking of expressed
prME protein, we have included JEss signal coding sequence
GAGGTCCGCCGGCTCAATCATGTGGCTCGCGAGCTTGGCAGTTGTCATAGCTTGTGCAGGCGCC,
DNA Vaccine Design and Adjuvant Selection
411