7. DNA purification kit (see Note 4).
8. Genomic cleavage assay kit (see Note 5).
9. Forward and Reverse primers for the PCR step in genomic
cleavage assay: GACGTAAACGGCCACAAGTT (Forward).
GCGGATCTTGAAGTTCACCT (Reverse).
10. Gel electrophoresis setup.
11. Agarose.
12. 10Â Tris/Acetate/EDTA (TAE) buffer: 400 mM Tris–acetate,
10 mM EDTA, pH 8.0 (see Note 6).
13. 10 mg/mL Ethidium bromide (Bio-Rad) (see Note 7).
14. 1 kb DNA ladder.
3 Methods
3.1 Electrospun Fiber
Scaffold Preparation
1. Prepare electrospun fiber scaffolds by electrospinning [14, 17]
(see Note 8).
2. Melt 1 g of PCL (40 kDa) at 60
C for 30 min to form a PCL
block in a mold (see Note 9). After this PCL block is formed,
trim the block down to 10 mm by 5 mm by 10 mm before
using a cryostat to section this block into small strips of PCL
films of 20 μm thickness.
3. Dissolve PCL (80 kDa) in TFE (14% W/V) overnight.
4. Vortex the solution until homogenous.
5. Before electrospinning, adhere the small strips of PCL films
(40 kDa) with 20 μm thickness onto glass coverslips (diameter
ϕ 18 mm) to create a 10 mm  10 mm area. Place these PCL
films onto the coverslips to form a square configuration before
melting them on a hotplate, at 50
C for 15 s. Remove coverslips from hotplate once these films turn transparent.
6. Fix 8 coverslips on a rotating collector (ϕ ¼ 15 cm) with carbon
tapes.
7. Electrospin the PCL fibers onto the coverslips that are fixed on
a rotating collector (2400 rpm). Apply a flow rate of 1.0 mL/
h and voltages of +8 kV and À4 kV to the needle tip and
rotating collector, respectively. Fix the spinneret-to-collector
distance at 21 cm. Allow electrospinning to occur for 6 min
30 s (100 μL of 14% W/V PCL solution electrospun) before
removing the coverslips off the rotating collector.
8. Secure the electrospun PCL fibers onto the coverslips with
silicone glue. Using a fine paintbrush, apply a small amount
of silicone glue along the parameter of the square configuration
formed by small strips of PCL films (refer to step 5). Allow
186
Wai Hon Chooi et al.
8. Genomic cleavage assay kit (see Note 5).
9. Forward and Reverse primers for the PCR step in genomic
cleavage assay: GACGTAAACGGCCACAAGTT (Forward).
GCGGATCTTGAAGTTCACCT (Reverse).
10. Gel electrophoresis setup.
11. Agarose.
12. 10Â Tris/Acetate/EDTA (TAE) buffer: 400 mM Tris–acetate,
10 mM EDTA, pH 8.0 (see Note 6).
13. 10 mg/mL Ethidium bromide (Bio-Rad) (see Note 7).
14. 1 kb DNA ladder.
3 Methods
3.1 Electrospun Fiber
Scaffold Preparation
1. Prepare electrospun fiber scaffolds by electrospinning [14, 17]
(see Note 8).
2. Melt 1 g of PCL (40 kDa) at 60
C for 30 min to form a PCL
block in a mold (see Note 9). After this PCL block is formed,
trim the block down to 10 mm by 5 mm by 10 mm before
using a cryostat to section this block into small strips of PCL
films of 20 μm thickness.
3. Dissolve PCL (80 kDa) in TFE (14% W/V) overnight.
4. Vortex the solution until homogenous.
5. Before electrospinning, adhere the small strips of PCL films
(40 kDa) with 20 μm thickness onto glass coverslips (diameter
ϕ 18 mm) to create a 10 mm  10 mm area. Place these PCL
films onto the coverslips to form a square configuration before
melting them on a hotplate, at 50
C for 15 s. Remove coverslips from hotplate once these films turn transparent.
6. Fix 8 coverslips on a rotating collector (ϕ ¼ 15 cm) with carbon
tapes.
7. Electrospin the PCL fibers onto the coverslips that are fixed on
a rotating collector (2400 rpm). Apply a flow rate of 1.0 mL/
h and voltages of +8 kV and À4 kV to the needle tip and
rotating collector, respectively. Fix the spinneret-to-collector
distance at 21 cm. Allow electrospinning to occur for 6 min
30 s (100 μL of 14% W/V PCL solution electrospun) before
removing the coverslips off the rotating collector.
8. Secure the electrospun PCL fibers onto the coverslips with
silicone glue. Using a fine paintbrush, apply a small amount
of silicone glue along the parameter of the square configuration
formed by small strips of PCL films (refer to step 5). Allow
186
Wai Hon Chooi et al.