2.8 Linker Ligation
1. 4Â Ligation buffer: 200 mM Tris–HCl, pH 7.8, 40 mM
MgCl 2 , 40 mM DTT.
2. T4 RNA ligase 1 (30,000 U/mL).
3. 50% Polyethylene glycol 8000 (PEG8000).
4. RiboLock RNase Inhibitor (Thermo Fisher Scientific).
5. 20 μM Pre-adenylated L3 adapter (rAppAGATCGGAAGAGCGGTTCAG/ddC/).
6. High-salt buffer (see Subheading 2.7).
2.9 Radioactive
Labeling of RNA
1. 4Â NuPAGE™ LDS sample buffer (Thermo Fisher Scientific).
2. T4 polynucleotide kinase (T4 PNK) and 10Â buffer A
(Thermo Fisher Scientific).
3. [γ32
P] ATP (370 MBq/mL).
4. RiboLock RNase Inhibitor (Thermo Fisher Scientific).
5. PNK wash buffer (pH 7.4) (see Subheading 2.5).
2.10 SDS PAGE
1. 20Â 3-(N-Morpholino)propanesulfonic acid (MOPS) SDS
running buffer: 50 mM MOPS, 50 mM Tris, 0.1% SDS,
1 mM EDTA, pH 7.7 (see Note 2).
2. Precast 4–12% NuPAGE Bis-Tris gel (Thermo Fisher Scientific) (see Note 3).
3. XCell SureLock™ Mini-Cell Electrophoresis System (Thermo
Fisher Scientific).
4. Prestained protein ladder.
2.11 Blot and
Isolation of RNAProtein Complexes
1. Transfer buffer: 25 mM Tris, 192 mM glycine, 0.05% SDS,
10% (v/v) methanol (add freshly).
2. 10Â Phosphate-buffered saline (PBS): 79 mM Na 2 HPO 4 ,
145 mM KH 2 PO 4 , 5 mM MgCl 2 x 6 H 2 O, 27 mM KCl,
1.37 M NaCl.
3. XCell SureLock™ Mini-Cell Electrophoresis System (Thermo
Fisher Scientific).
4. XCell II Blot Module (Thermo Fisher Scientific).
5. Whatman filter paper.
6. Protran BA-85 nitrocellulose membrane (Sigma-Aldrich).
7. Saran wrap.
8. Autoradiography exposure cassette.
9. Fluorescent ruler.
10. X-ray film.
11. Standard X-ray film processing chemicals/equipment (e.g.,
Kodak).
12. Clean scalpels.
Plant iCLIP
259