conjugated the primary antibody to AuNP allowing to improve the LOD of estriol
from 0.2 to 0.03 μg L
À1 , but no data is shown comparing the performance of this
strategy in respect to the use of secondary gold probes.
Frasconi et al. (2010) functionalized the Au nanoparticles (NPs) with thioaniline
electropolymerizable groups and (mercapto-phenyl) boronic acid wherein antibiotic
substrates neomycin (NE), kanamycin (KA), and streptomycin (ST) include vicinal
diol functionalities which were specifically bound to the boronic acid ligands leading
to electropolymerization of the functionalized Au NPs onto Au surfaces yields
bisaniline-cross-linked Au-NP composites that, after removal of the ligated antibiotics, provide molecularly imprinted matrixes which reveal high sensitivities toward
the sensing of the imprinted antibiotic analytes (detection limits for analyzing NE,
KA, and ST correspond to 2.00 Æ 0.21 pM, 1.00 Æ 0.10 pM, and 200 Æ 30 fM,
respectively).
Another researcher has discovered a selective kanamycin-binding single-strand
DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) through in vitro
selection using affinity chromatography with kanamycin-immobilized sepharose
beads (Song et al. 2011). The SS DNA Aptamer linked with gold nanoparticle for
the selective detection of kanamycin and its derivatives such as kanamycin B and
tobramycin with a detection limit of 25 nM by visual observation or by colorimetric
method. A colorimetric and fluorescence quenching aptasensors for detection of
streptomycin in milk based on double-stranded DNA and gold nanoparticles have
been attempted by Emrani et al. (2016). The aptamer/FAM-labeled complementary
dsDNA strand is stable, resulting in the aggregation of AuNPs by salt and an obvious
color change from red to blue and strong emission of fluorescence in the absence of
streptomycin (Emrani et al. 2016). In the presence of streptomycin, aptamer binds to
its target, and FAM-labeled complementary strand adsorbs on the surface of AuNPs.
Therefore, the well-dispersed AuNPs continue to be stable against salt-induced
aggregation with a wine-red color, and the fluorescence of FAM-labeled complimentary strand is efficiently quenched by AuNPs. The colorimetric and fluorescence
quenching aptasensors showed excellent selectivity toward streptomycin with the
limit of detections as low as 73.1 and 47.6 nM, respectively.
Other efforts by Font et al. (2008) have developed two direct enzyme-linked
immunosorbent assays (ELISAs) which have been developed for detection of
sulfonamide antibiotic residues in milk samples using magnetic nanoparticles
(MNP) for target capture/enrichment (Ab-MNP-ELISA) and further assay
performed using microtiter plates. In this assay, selective polyclonal antibodies
were raised against 5-[6-(4-amino-benzenesulfonylamino)-pyridin-3-yl]-2-methylpentanoic acid (SA1), used in combination with an enzyme tracer prepared with
the same hapten, so has to achieve a limit of detection (LOD) lower than 0.5 μg L
À1
by both ELISA formats. Sulfapyridine, sulfamethoxypyridazine, sulfathiazole, and
sulfachloropyridazine are detected below the maximum residue limits established by
the European Union for these antibiotics in milk (100 μg L
À1 ). Silver nanoparticle
that enhanced the fluorescence of europium (III) for detection of tetracycline in milk
has been investigated by Tan and Chen (2012) based on the coordination of Tc with
europium functionalized on the surface of AgNPs to become EuTc complex for the
106
H. V. Raghu et al.
from 0.2 to 0.03 μg L
À1 , but no data is shown comparing the performance of this
strategy in respect to the use of secondary gold probes.
Frasconi et al. (2010) functionalized the Au nanoparticles (NPs) with thioaniline
electropolymerizable groups and (mercapto-phenyl) boronic acid wherein antibiotic
substrates neomycin (NE), kanamycin (KA), and streptomycin (ST) include vicinal
diol functionalities which were specifically bound to the boronic acid ligands leading
to electropolymerization of the functionalized Au NPs onto Au surfaces yields
bisaniline-cross-linked Au-NP composites that, after removal of the ligated antibiotics, provide molecularly imprinted matrixes which reveal high sensitivities toward
the sensing of the imprinted antibiotic analytes (detection limits for analyzing NE,
KA, and ST correspond to 2.00 Æ 0.21 pM, 1.00 Æ 0.10 pM, and 200 Æ 30 fM,
respectively).
Another researcher has discovered a selective kanamycin-binding single-strand
DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) through in vitro
selection using affinity chromatography with kanamycin-immobilized sepharose
beads (Song et al. 2011). The SS DNA Aptamer linked with gold nanoparticle for
the selective detection of kanamycin and its derivatives such as kanamycin B and
tobramycin with a detection limit of 25 nM by visual observation or by colorimetric
method. A colorimetric and fluorescence quenching aptasensors for detection of
streptomycin in milk based on double-stranded DNA and gold nanoparticles have
been attempted by Emrani et al. (2016). The aptamer/FAM-labeled complementary
dsDNA strand is stable, resulting in the aggregation of AuNPs by salt and an obvious
color change from red to blue and strong emission of fluorescence in the absence of
streptomycin (Emrani et al. 2016). In the presence of streptomycin, aptamer binds to
its target, and FAM-labeled complementary strand adsorbs on the surface of AuNPs.
Therefore, the well-dispersed AuNPs continue to be stable against salt-induced
aggregation with a wine-red color, and the fluorescence of FAM-labeled complimentary strand is efficiently quenched by AuNPs. The colorimetric and fluorescence
quenching aptasensors showed excellent selectivity toward streptomycin with the
limit of detections as low as 73.1 and 47.6 nM, respectively.
Other efforts by Font et al. (2008) have developed two direct enzyme-linked
immunosorbent assays (ELISAs) which have been developed for detection of
sulfonamide antibiotic residues in milk samples using magnetic nanoparticles
(MNP) for target capture/enrichment (Ab-MNP-ELISA) and further assay
performed using microtiter plates. In this assay, selective polyclonal antibodies
were raised against 5-[6-(4-amino-benzenesulfonylamino)-pyridin-3-yl]-2-methylpentanoic acid (SA1), used in combination with an enzyme tracer prepared with
the same hapten, so has to achieve a limit of detection (LOD) lower than 0.5 μg L
À1
by both ELISA formats. Sulfapyridine, sulfamethoxypyridazine, sulfathiazole, and
sulfachloropyridazine are detected below the maximum residue limits established by
the European Union for these antibiotics in milk (100 μg L
À1 ). Silver nanoparticle
that enhanced the fluorescence of europium (III) for detection of tetracycline in milk
has been investigated by Tan and Chen (2012) based on the coordination of Tc with
europium functionalized on the surface of AgNPs to become EuTc complex for the
106
H. V. Raghu et al.