11. Incubator for agar plates at 37
C.
12. Sterile petri dishes.
13. Shaker for liquid cultures (15 mL Falcon tubes) for incubation
at 180–200 rpm and 37
C.
14. Sterile 15 mL Falcon tubes.
15. Antibiotics, 1000Â stock solutions, sterilized by filtration
through 0.22 μm pore-size membrane:
(a) Zeocin: 20 mg/mL (in water).
(b) Ampicillin: 100 mg/mL (in water).
(c) Kanamycin: 50 mg/mL (in water).
(d) Spectinomycin: 50 mg/mL (in water).
(e) Chloramphenicol: 34 mg/mL (in 100% ethanol).
16. For the color screening of bacterial colonies containing the
desired plasmid with insert:
(a) IPTG solution: 0.1 M IPTG in water.
(b) X-gal solution: 50 mg/mL X-gal in dimethyl sulfoxide
(DMSO).
17. Plasmid DNA isolation kit (e.g., NucleoSpin
® Plasmid kit,
Macherey-Nagel).
18. Benchtop centrifuge (able to hold 1.5 mL tubes and providing
15,000 Â g).
19. PacI DNA restriction endonuclease.
20. SacI DNA restriction endonuclease.
21. T4 DNA ligase.
22. pSL-MS2 plasmids containing the MSL tandem sequence
(6, 12, or 24 SL copies) and plasmid pMS2-GFP containing
the MCP gene (see Note 1).
23. pDONR™/Zeo Vector (Thermo Fisher) and BP™ and LR™
clonase enzyme mixes (Thermo Fisher) for Gateway
® -compatible cloning.
24. Binary Gateway
® destination vector pMDC32 for propagation
in E. coli and for use as vector for A. tumefaciens-mediated
transient expression in plants [64] (see Note 2).
25. Oligonucleotide primers:
(a) MS2-12SLfw: 5
0 ttaattaacgggccctatatatggatcc
(b) MS2-12SLrev: 5
0 gagctccgctgatatcgatcgcgcgc
(c) T7: 5
0 taatacgactcactataggg
(d) SP6: 5
0 gatttaggtgacactatag
(e) ccdBfw: 5
0 -cacctataaaagagagagcc
(f) T-nosrev: 5
0 -aatcatcgcaagaccgg
(g) M13fw: 5
0 -tgtaaaacgacggccagt
RNA Imaging in Plants Using MS2
109
C.
12. Sterile petri dishes.
13. Shaker for liquid cultures (15 mL Falcon tubes) for incubation
at 180–200 rpm and 37
C.
14. Sterile 15 mL Falcon tubes.
15. Antibiotics, 1000Â stock solutions, sterilized by filtration
through 0.22 μm pore-size membrane:
(a) Zeocin: 20 mg/mL (in water).
(b) Ampicillin: 100 mg/mL (in water).
(c) Kanamycin: 50 mg/mL (in water).
(d) Spectinomycin: 50 mg/mL (in water).
(e) Chloramphenicol: 34 mg/mL (in 100% ethanol).
16. For the color screening of bacterial colonies containing the
desired plasmid with insert:
(a) IPTG solution: 0.1 M IPTG in water.
(b) X-gal solution: 50 mg/mL X-gal in dimethyl sulfoxide
(DMSO).
17. Plasmid DNA isolation kit (e.g., NucleoSpin
® Plasmid kit,
Macherey-Nagel).
18. Benchtop centrifuge (able to hold 1.5 mL tubes and providing
15,000 Â g).
19. PacI DNA restriction endonuclease.
20. SacI DNA restriction endonuclease.
21. T4 DNA ligase.
22. pSL-MS2 plasmids containing the MSL tandem sequence
(6, 12, or 24 SL copies) and plasmid pMS2-GFP containing
the MCP gene (see Note 1).
23. pDONR™/Zeo Vector (Thermo Fisher) and BP™ and LR™
clonase enzyme mixes (Thermo Fisher) for Gateway
® -compatible cloning.
24. Binary Gateway
® destination vector pMDC32 for propagation
in E. coli and for use as vector for A. tumefaciens-mediated
transient expression in plants [64] (see Note 2).
25. Oligonucleotide primers:
(a) MS2-12SLfw: 5
0 ttaattaacgggccctatatatggatcc
(b) MS2-12SLrev: 5
0 gagctccgctgatatcgatcgcgcgc
(c) T7: 5
0 taatacgactcactataggg
(d) SP6: 5
0 gatttaggtgacactatag
(e) ccdBfw: 5
0 -cacctataaaagagagagcc
(f) T-nosrev: 5
0 -aatcatcgcaagaccgg
(g) M13fw: 5
0 -tgtaaaacgacggccagt
RNA Imaging in Plants Using MS2
109
