GAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT.
LipL32 is a constitutive, high-copy number protein from pathogenic strains, and its promoter has been shown to be functional in L. biflexa. Other functional promoters could be used
to drive sgRNA transcription, but it is important to have the
TSS well defined.
5. The sgRNA cassette can be obtained by ordering a synthetic
gene or by PCR. With regard to PCR, we have succeeded in
amplifying the lipL32 promoter from genomic DNA of
L. interrogans and including the 20 nt and scaffold sequence
at the 5
0 end of the reverse primer. In both forward and reverse
primer ends, include a XmaI restriction site (CCCGGG). The
PCR mixture (50 μL) contains 1Â PCR buffer, 2 mM MgCl 2
(some PCR buffers already contain magnesium), 0.2 mM
dNTP mix, 0.5 μM forward and reverse primers (p32F and
R), and 1 U DNA polymerase (see Notes 4 and 5).
6. Digest sgRNA cassette and pMaOri.dCas9 with XmaI enzyme.
Purify the digested products directly from the reaction mixture,
and perform the ligation with a 1:10 molar ratio plasmid to
insert. First, mix plasmid, insert and water (11 μL reaction
mixture), and heat at 65
C for 10 min. After cooling, add
the ligation buffer (normally 5Â, add 3 μL) and T4 DNA ligase
(1 μL, 1 U). The final volume of the reaction mixture is 15 μL,
and the reaction is carried out for 1 h at room temperature.
Alternatively, pMaOri.dCas9 digested with XmaI can be treated with calf intestinal alkaline phosphatase (CIP) to increase
ligation efficiency.
Fig. 2 Construction of sgRNA cassette. Protospacers within genomic targets are selected based on the
presence of a 3
0 PAM (protospacer adjacent motif) composed of NGG. For full gene silencing, it is required
pairing between sgRNA and coding strand. Thus, protospacer is selected in the template strand, and to its
sequence, a 3
0 scaffold sequence is added. For sgRNA transcription, we have been using lipL32 promoter, from
À334 to its TSS
Gene Silencing by Single-Guide RNA and dCas9
115
LipL32 is a constitutive, high-copy number protein from pathogenic strains, and its promoter has been shown to be functional in L. biflexa. Other functional promoters could be used
to drive sgRNA transcription, but it is important to have the
TSS well defined.
5. The sgRNA cassette can be obtained by ordering a synthetic
gene or by PCR. With regard to PCR, we have succeeded in
amplifying the lipL32 promoter from genomic DNA of
L. interrogans and including the 20 nt and scaffold sequence
at the 5
0 end of the reverse primer. In both forward and reverse
primer ends, include a XmaI restriction site (CCCGGG). The
PCR mixture (50 μL) contains 1Â PCR buffer, 2 mM MgCl 2
(some PCR buffers already contain magnesium), 0.2 mM
dNTP mix, 0.5 μM forward and reverse primers (p32F and
R), and 1 U DNA polymerase (see Notes 4 and 5).
6. Digest sgRNA cassette and pMaOri.dCas9 with XmaI enzyme.
Purify the digested products directly from the reaction mixture,
and perform the ligation with a 1:10 molar ratio plasmid to
insert. First, mix plasmid, insert and water (11 μL reaction
mixture), and heat at 65
C for 10 min. After cooling, add
the ligation buffer (normally 5Â, add 3 μL) and T4 DNA ligase
(1 μL, 1 U). The final volume of the reaction mixture is 15 μL,
and the reaction is carried out for 1 h at room temperature.
Alternatively, pMaOri.dCas9 digested with XmaI can be treated with calf intestinal alkaline phosphatase (CIP) to increase
ligation efficiency.
Fig. 2 Construction of sgRNA cassette. Protospacers within genomic targets are selected based on the
presence of a 3
0 PAM (protospacer adjacent motif) composed of NGG. For full gene silencing, it is required
pairing between sgRNA and coding strand. Thus, protospacer is selected in the template strand, and to its
sequence, a 3
0 scaffold sequence is added. For sgRNA transcription, we have been using lipL32 promoter, from
À334 to its TSS
Gene Silencing by Single-Guide RNA and dCas9
115