4. Once all datasets are analyzed in the switchANALYSIS software, a publication-quality image could be copied in the clipboard. Raw datasets could also be exported in various file
formats (ASCII, Excel, etc.) compatible with other software
tools.
3.5 Consideration
About Obtained
Kinetics Parameters
Polymerization rate is only fitted during the first 30 s of the reaction. As for classical studies in enzymology, this time window
corresponds to the initial linear part allowing to measure initial
rate of the reaction, before the substrate becomes limiting.
In this experiment datasets, please note that the determined
k ON value stands for the association of polymerase on a 5
0 protruding DNA strand and that the k OFF value stands for dissociation of
the polymerase from a fully extended blunt end DNA. Therefore,
no proper K D value (usually deduced from the ratio
k OFF
k ON
) could be
calculated, because of the change in the nature of the substrate that
occurs during polymerization. K D of the polymerase for both forms
of the DNA could be calculated using a different experimental set
using the polymerase as an analyte and two complementary DNA
nanolevers of 36 or 80 nucleotides long as ligands.
4 Notes
1. P36T80 oligonucleotide (GAGTAACCTGAAGTGTGAGCATAAAGAGTGATGTAA) was chemically synthetized at a
250 nmoles scale, followed by a standard desalting.
2. This construct constitutes the substrate of the polymerase
where P36T80 is the primer strand oligonucleotide, and template strand is the 80-mer DNA probe attached on the chip on
its 3
0 end.
3. The enzyme concentration is kept constant in the fluidic system
during polymerization to maintain the balance of associated/
dissociated polymerase on the DNA substrate.
4. During this step, the fluorescence increases significantly
because the dye moves away from the fluorescence-quenching
surface as the polymerase converts the upper DNA part from a
floppy single- to a rigid double strand.
5. As for many polymerase-involved reactions, heparin is used as a
trap to ensure that the dissociated polymerase do not
re-associate on the DNA nanolever. The use of heparin allows
the same fluorescent signal amplitude to be recovered for dissociation as for the association step.
Analysis of a DNA Polymerase Using switchSENSE Approach
151
Précédent

- 158/338

Suivant