duplexes (18 bp and 42 bp). The K d expected from the literature is
in the nM range [4].
1. The Ku heterodimer is produced and purified as described in
[10]. The complex Ku is expressed in insect cells and purified
using Ni-NTA affinity purification (Thermo Fisher Scientific)
followed by an anion exchange chromatography using a
Resource-Q column (GE Healthcare Life Science) [10]. Insect
cell pellets from 1.2 l culture classically yield 80 mg purified Ku
at the end of the protocol, which is sufficient for about
200 titrations Ku vs DNA.
2. 18 nt or 42 nt DNA oligonucleotides and their complementary
strands are synthetized at the 1 μmole scale (Sigma Aldrich,
HPLC 95% pure). The sequence of the DNA 18 nt is
5
0 GTCTCACGCTCGGATAAC3
0 ; the sequence of the DNA
42 nt is 5
0 GAACGAAAACATCGGGTACGAGGACGAAG
ACTGACCACGACA3
0 . With a command at 1 μmole scale,
we obtained between 115 and 530 nmoles of oligonucleotides
that is sufficient for at least 35 titrations after hybridization.
3. A dialysis membrane with a molecular weight cut-off (MWCO)
of 30 kDa (Spectra/Por
® molecular porous membrane tubing); 2 l of ITC buffer (20 mM Tris-HCl, pH 8.0, 150 mM
NaCl, 5 mM β-mercaptoethanol) prepared with deionized
water (18 mΩ-cm
À1 at 25
C); Amicon
® Ultra-4 30 kDa ultrafiltration devices.
2.3 Equipment
for Microscale
Thermophoresis (MST)
1. Monolith NT.115: The Monolith NT.115 Blue/Green is
equipped with two LEDs (LED1: excitation 470 nm, emission
520 nm; LED2: excitation 550 nm, emission 600 nm, Nanotemper Technologies). The instrument is equipped with a sample tray that can process automatically up to 16 samples per run
in 10 min. MST is measured in capillaries with a total volume of
3–5 μl. Control software guides step-by-step planning and
assay setup. Binding values are obtained instantly, and results
are exportable. Affinity Analysis software enables advanced data
analysis like merging, grouping, or comparing data sets.
2. Capillaries: All capillaries are made of glass with infrared laser
quality. Standard Treated Capillaries (Nanotemper) are physically treated to ensure high-quality surface properties. Hydrophobic (Nanotemper) and Premium-Coated (Nanotemper)
Capillaries are covalently coated with a dense brush of specially
designed polymers to avoid molecule adsorption.
2.4 Samples for MST
MST is based on the detection of temperature-induced changes in
fluorescence of a target as a function of the concentration of a
non-fluorescent ligand. In typical experiments, 5–500 nM of the
fluorescently labeled molecule is used. The maximum ligand
Measurements of Protein–DNA Complexes Interactions by Isothermal. . .
131
in the nM range [4].
1. The Ku heterodimer is produced and purified as described in
[10]. The complex Ku is expressed in insect cells and purified
using Ni-NTA affinity purification (Thermo Fisher Scientific)
followed by an anion exchange chromatography using a
Resource-Q column (GE Healthcare Life Science) [10]. Insect
cell pellets from 1.2 l culture classically yield 80 mg purified Ku
at the end of the protocol, which is sufficient for about
200 titrations Ku vs DNA.
2. 18 nt or 42 nt DNA oligonucleotides and their complementary
strands are synthetized at the 1 μmole scale (Sigma Aldrich,
HPLC 95% pure). The sequence of the DNA 18 nt is
5
0 GTCTCACGCTCGGATAAC3
0 ; the sequence of the DNA
42 nt is 5
0 GAACGAAAACATCGGGTACGAGGACGAAG
ACTGACCACGACA3
0 . With a command at 1 μmole scale,
we obtained between 115 and 530 nmoles of oligonucleotides
that is sufficient for at least 35 titrations after hybridization.
3. A dialysis membrane with a molecular weight cut-off (MWCO)
of 30 kDa (Spectra/Por
® molecular porous membrane tubing); 2 l of ITC buffer (20 mM Tris-HCl, pH 8.0, 150 mM
NaCl, 5 mM β-mercaptoethanol) prepared with deionized
water (18 mΩ-cm
À1 at 25
C); Amicon
® Ultra-4 30 kDa ultrafiltration devices.
2.3 Equipment
for Microscale
Thermophoresis (MST)
1. Monolith NT.115: The Monolith NT.115 Blue/Green is
equipped with two LEDs (LED1: excitation 470 nm, emission
520 nm; LED2: excitation 550 nm, emission 600 nm, Nanotemper Technologies). The instrument is equipped with a sample tray that can process automatically up to 16 samples per run
in 10 min. MST is measured in capillaries with a total volume of
3–5 μl. Control software guides step-by-step planning and
assay setup. Binding values are obtained instantly, and results
are exportable. Affinity Analysis software enables advanced data
analysis like merging, grouping, or comparing data sets.
2. Capillaries: All capillaries are made of glass with infrared laser
quality. Standard Treated Capillaries (Nanotemper) are physically treated to ensure high-quality surface properties. Hydrophobic (Nanotemper) and Premium-Coated (Nanotemper)
Capillaries are covalently coated with a dense brush of specially
designed polymers to avoid molecule adsorption.
2.4 Samples for MST
MST is based on the detection of temperature-induced changes in
fluorescence of a target as a function of the concentration of a
non-fluorescent ligand. In typical experiments, 5–500 nM of the
fluorescently labeled molecule is used. The maximum ligand
Measurements of Protein–DNA Complexes Interactions by Isothermal. . .
131
