6. By using mutation specific primers, one can identify which
candidates contain the SNP by MAMA-PCR or similar techniques (see Note 13).
7. For SNP-containing candidates identified by PCR, clean the
PCR products enzymatically (for example, with NEB ExoSapIT) and verify the presence of the SNP by DNA sequencing (see
Note 14).
8. Alternative methodologies for the preparation of heat-killed
cells and for the identification of mycobacterial colonies that
contain the SNP are described in Notes 15 and 16,
respectively.
3.4 Electroporation
of Oligonucleotides
and attBcontaining Plasmids
for ORBIT
1. In designing the ORBIT oligo using a DNA sequence editing
program, place the 48-base pair attP sequence into the desired
position of a target gene sequence file. For deletions, the attP
site should be inserted in place of the target gene in a position
that leaves the first 30 bases and the last 30 bases of the target
gene sequence intact (see Note 17). For construction of a
C-terminal fusion, the attP site should be inserted between
the last codon and the stop codon of the target gene. The attP
sequence is:
GGTTTGTCTGGTCAACCACC GCGGTCTC AGTGGTG
TACGGTACAAACC; the core sequence is underlined.
2. As in the SNP transfer protocol, the ORBIT oligo sequences
must correspond to the lagging strand of the replication fork.
Once the attP site is inserted into the sequence file of the target
gene as desired, select the attP site and the 70 bases flanking it
(188 bases total). The ORBIT oligo will either be the top strand
or its reverse complement. To decide which of these alternatives
is chosen, follow the rules as described in Table 2. Examples of
oligo sequences used in the ORBIT protocol for deletion of four
M. tuberculosis target genes are shown in Fig. 3.
3. The preparation of electrocompetent/recombinogenic
M. tuberculosis cells for the ORBIT protocol is the same as
described for the SNP transfer protocol in Subheading 3.1,
except that M. tuberculosis cells containing plasmid pKM461
must be used; cells are grown in 7H10-OADC-tween containing 20 μg/mL kanamycin. Plasmid pKM461 expresses both
RecT and Bxb1 Integrase under control of the Ptet promoter.
4. Mix 1 μg of the ORBIT oligo with 200 ng of a nonreplicating
attB-containing ORBIT integrating plasmid in a sterile Eppendorf tube. The choice of which attB-containing integrating
plasmid to use depends on which type of gene modification is
desired (see Table 1). Bring the mixture to a final volume of
10 μL with sterile distilled water.
312
Kenan C. Murphy
candidates contain the SNP by MAMA-PCR or similar techniques (see Note 13).
7. For SNP-containing candidates identified by PCR, clean the
PCR products enzymatically (for example, with NEB ExoSapIT) and verify the presence of the SNP by DNA sequencing (see
Note 14).
8. Alternative methodologies for the preparation of heat-killed
cells and for the identification of mycobacterial colonies that
contain the SNP are described in Notes 15 and 16,
respectively.
3.4 Electroporation
of Oligonucleotides
and attBcontaining Plasmids
for ORBIT
1. In designing the ORBIT oligo using a DNA sequence editing
program, place the 48-base pair attP sequence into the desired
position of a target gene sequence file. For deletions, the attP
site should be inserted in place of the target gene in a position
that leaves the first 30 bases and the last 30 bases of the target
gene sequence intact (see Note 17). For construction of a
C-terminal fusion, the attP site should be inserted between
the last codon and the stop codon of the target gene. The attP
sequence is:
GGTTTGTCTGGTCAACCACC GCGGTCTC AGTGGTG
TACGGTACAAACC; the core sequence is underlined.
2. As in the SNP transfer protocol, the ORBIT oligo sequences
must correspond to the lagging strand of the replication fork.
Once the attP site is inserted into the sequence file of the target
gene as desired, select the attP site and the 70 bases flanking it
(188 bases total). The ORBIT oligo will either be the top strand
or its reverse complement. To decide which of these alternatives
is chosen, follow the rules as described in Table 2. Examples of
oligo sequences used in the ORBIT protocol for deletion of four
M. tuberculosis target genes are shown in Fig. 3.
3. The preparation of electrocompetent/recombinogenic
M. tuberculosis cells for the ORBIT protocol is the same as
described for the SNP transfer protocol in Subheading 3.1,
except that M. tuberculosis cells containing plasmid pKM461
must be used; cells are grown in 7H10-OADC-tween containing 20 μg/mL kanamycin. Plasmid pKM461 expresses both
RecT and Bxb1 Integrase under control of the Ptet promoter.
4. Mix 1 μg of the ORBIT oligo with 200 ng of a nonreplicating
attB-containing ORBIT integrating plasmid in a sterile Eppendorf tube. The choice of which attB-containing integrating
plasmid to use depends on which type of gene modification is
desired (see Table 1). Bring the mixture to a final volume of
10 μL with sterile distilled water.
312
Kenan C. Murphy