2.2 Electroporation
of Oligonucleotides
Substrates for SNP
Transfer
in M. tuberculosis
1. SNP-containing oligos: Dissolve oligos (70 mers) from manufacturer to a final concentration of 1 g/L in 10 mM Tris–HCl,
pH 8.0 (or sterile water); dilute stock as needed. Oligos do not
have be purified by HPLC or cut out of agarose gels.
2. Hyg
repair oligo: A 70-base oligo that contains an internal
sequence of the hygromycin phosphotransferase gene (see
Note 1). Sequence of the Hgy
repair oligo is: CGGTCCAG
CAGCCGGGGCGAGAGGTAGCCCCACCCGCGGTGGT
CCTCGACGGTCGCCGCG. Dissolve the oligo from manufacturer to a final concentration of 0.3–1 g/L in 10 mM Tris–
HCl, pH 8.0 (or sterile water); dilute stock as needed.
3. H37Rv strain (obtained from Christopher Sassetti, University
of Massachusetts Medical School, Worcester, MA).
4. 7H9-OADC-Tween 80 media and 7H10 plates (see items 4
and 5 in Subheading 2.1).
5. 50 μg/mL Hygromycin B: Supplied as a solution in PBS
(Roche); store at 4
C in the dark.
6. Electroporation apparatus: capable of delivering a pulse at settings of 2.5 kV, 1000 Ω.
7. Small sterile disposable transfer pipettes (1 mL) individually
packaged consisting of a small bulb and extended fine tip.
8. Electroporation cuvettes (0.2 cm gap).
9. Nalgene Inkwell bottles (30 mL capacity).
10. Sterile Eppendorf tubes.
11. Aluminum foil.
2.3 SNP-Transfer
Identification
and Verification
1. 7H9-OADC-Tween 80 media and 7H10 plates (see items 4
and 5 in Subheading 2.1).
2. 50 μg/mL Hygromycin B: Supplied as a solution in PBS
(Roche); store at 4
C in the dark.
3. 24 well plates and sterile sealing membranes.
4. Aluminum foil.
5. Sterile loops for picking colonies.
6. Screw capped plastic tubes (1.5 mL capacity).
7. Hot metal bead bath set to 85
C.
8. Taq polymerase.
9. Primers for recombinant verifications by PCR.
2.4 Electroporation
of Oligonucleotides
and attBcontaining Plasmids
for ORBIT
1. pKM461: The plasmid expresses Che9 RecT and Bxb1 Integrase from the inducible Ptet promoter; it is Kan
R (addgene.
com).
2. ORBIT attP-containing oligos: A long oligonucleotide
(188 mer) for use in the ORBIT protocol contains the
306
Kenan C. Murphy
of Oligonucleotides
Substrates for SNP
Transfer
in M. tuberculosis
1. SNP-containing oligos: Dissolve oligos (70 mers) from manufacturer to a final concentration of 1 g/L in 10 mM Tris–HCl,
pH 8.0 (or sterile water); dilute stock as needed. Oligos do not
have be purified by HPLC or cut out of agarose gels.
2. Hyg
repair oligo: A 70-base oligo that contains an internal
sequence of the hygromycin phosphotransferase gene (see
Note 1). Sequence of the Hgy
repair oligo is: CGGTCCAG
CAGCCGGGGCGAGAGGTAGCCCCACCCGCGGTGGT
CCTCGACGGTCGCCGCG. Dissolve the oligo from manufacturer to a final concentration of 0.3–1 g/L in 10 mM Tris–
HCl, pH 8.0 (or sterile water); dilute stock as needed.
3. H37Rv strain (obtained from Christopher Sassetti, University
of Massachusetts Medical School, Worcester, MA).
4. 7H9-OADC-Tween 80 media and 7H10 plates (see items 4
and 5 in Subheading 2.1).
5. 50 μg/mL Hygromycin B: Supplied as a solution in PBS
(Roche); store at 4
C in the dark.
6. Electroporation apparatus: capable of delivering a pulse at settings of 2.5 kV, 1000 Ω.
7. Small sterile disposable transfer pipettes (1 mL) individually
packaged consisting of a small bulb and extended fine tip.
8. Electroporation cuvettes (0.2 cm gap).
9. Nalgene Inkwell bottles (30 mL capacity).
10. Sterile Eppendorf tubes.
11. Aluminum foil.
2.3 SNP-Transfer
Identification
and Verification
1. 7H9-OADC-Tween 80 media and 7H10 plates (see items 4
and 5 in Subheading 2.1).
2. 50 μg/mL Hygromycin B: Supplied as a solution in PBS
(Roche); store at 4
C in the dark.
3. 24 well plates and sterile sealing membranes.
4. Aluminum foil.
5. Sterile loops for picking colonies.
6. Screw capped plastic tubes (1.5 mL capacity).
7. Hot metal bead bath set to 85
C.
8. Taq polymerase.
9. Primers for recombinant verifications by PCR.
2.4 Electroporation
of Oligonucleotides
and attBcontaining Plasmids
for ORBIT
1. pKM461: The plasmid expresses Che9 RecT and Bxb1 Integrase from the inducible Ptet promoter; it is Kan
R (addgene.
com).
2. ORBIT attP-containing oligos: A long oligonucleotide
(188 mer) for use in the ORBIT protocol contains the
306
Kenan C. Murphy